%PDF-1.5 % 1 0 obj <>>> endobj 2 0 obj <> endobj 3 0 obj <>/ExtGState<>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> endobj 4 0 obj <> stream x\Ko 6dGd#^ l+ɋ[N{1{d=S&%bKLzfv:,MLyﻢ}9]}sb8? `494Eӟ_EiH/LfDTK)o\ln|o{RzRP{gzKԔDDyIOhh N_onЈx0;8vMK_F-Cab7OY>J%P(t'eKV^*=ϋyAPhd\ ŝ o}/y=hXـibDtlGiwlki,p+OXş$#HAFڸ =RT2G{!e_`to4A*&eZk!AB92q)vrCR*$$.rKX[9Ui|4i|)eH<#J-0;rr}"$|/ v&s7ID\\Mpj9ueؼR$D}N>MGay6ZD:(F)$k+EkOa-H4v;fyN_*D9YsZj$?_<48 <޹U g6"ENKO|n ߌY=s>ΧAv[NE_u$"ڪ֭(5~KvXyT8!·8S |?oaoԡ\v6W(C6lUfVc Y5gw(lD>4%OfP"_-_~-X4FҾb[R'4c;n#D5nm'Li%jTxY5\C |u$ˎgdY@9?>CwĠI\|n@/YF"SKTl{ΓHtqcTpB8yjݢqb rOs}Z!zܭcEÞ-POyL ,ToZ4V D%\]R)TxNLVĉH'qS,8Ȝ\Ϛe2(i\4lO /HNﱘ9=~Hj`e::\;m~?B87ع[ (t wOnVC*]-C_L&BWz#R!ȊĞ s۵G)ttLkD 4E꠷[4JV*[5ȼ11b˪FItMQ[hrr6_g=R iW+i5\j?{P9wcU`MULm t*ː *F՗Ui'z@[6"D[) ťg(ΐ e-TcD[*v}cz6;Eb8 D_"@O"Zg|?&ղ!HW6TqB5#cUiy'§ endstream endobj 5 0 obj <> endobj 6 0 obj <> endobj 7 0 obj <> endobj 8 0 obj <> endobj 9 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( *ޫee4!Y3xH/5\e NӒ6Mce?$'D'P~.nf˻w=*^gR冑=>  pGR% ss ^jm%m%pkO#w3m27m"q?*-!Xa\({jzGޖ2|LQXTt ׬e6=kïFTj:r:4Mi}sbe^Euga+zc[uζU׹TW--f3Hz 4>ljZ˖AEWIQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEV=>$*x\wp۝>է=Cwl=۹_+jW{,?3݅tc-upFڨzT B!"H]Nm5OW=˰re*vZ%MKSH*QK%F``0X(=K_I:pǍ:V 2y-VmпA+IDV5 )!>Y($HQ}&F3R2snrqQ |f|sC\C)RA zeЯYjܰVaMxQ(ݽz8)oCxwU2(e'v{ym1̅v5;E*ȇk)## 7ގԣZGX]s=z_i J;3fUGY+;!&v=q#vװ,O }"p~qT"j+2z鲻t{-+"2FA Z+f;{i+8cfv'$گvUo,Iq*ƥl<ʀ-QYvk "隭Fqmpvtַkp-qFFA9@TV0^[qm4s"IbppEW?c8^: V&Eֹs t ^lw}ǰU0yҬ1yTgri/osq}w<~'ESm7VZ^"ki@?jԒ$1C10y~^3wM=1@Q5 jO4knKqsX';yRXePWR2#@QY#5kI\$d(c<'9Y,$HwvUG$z*ii' !]*ki.o."e"rx$r$$:n0==:햿naXiˊs@QXx77HiX$q{38$EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPU5+J/?Z\f+e#Z9csb*m=XI$䜓Z q[b|k>峅x<>aGUEG +IDш8E2I70}~W|+ S{KiŴr=qR+3[b~4]Zio+z!Ǎ]:Wz?vB4h?k/ԽUo6f?~U,,Q<¢?C`qX'y렒[,P)VXgSyTm\dܞjI"mesİX L{plI+"K6i[Jߩത ]bYzzWO\7>q ~]{9=Wշ^yLڔZo{%LJux1h_ʎ7XVk%o_Gv4g*U`5Y˫31{1~5/4FܱHSiXS=@/˻B(GGo1l߅AwvuzJC3Km۷̒z[7N:qV76cKK\2N{WW%/u^<)Y~~lAHI",MNa{? ezw_q@ I|ONH J1KA ;XN1J?@PW J {,sלzP/SjBC/9zKs [<ISTY' 2T>$ =c_4hz;x}_<ᕴ}ark~ ռ9ݨET\n*Qӵ;ojQsIn5+t5}K3,7#'#C޹n}mok^ 7D mbyTJ \5ޝ:_[3nԮqgEdx±\gAvm'nydA4 ?5_HKAcBc3򭻭#>FMil2wc?3O=a;عL \Nhz&x!KP3$p@8QcW"(UX 0Sg=_ECix[iݘ0gGާo9hxïo]hRyR\F>VUۑoL^"ejⴈ[^O6]MԦ0)BUKdH03=oNu/~k-vW83"e:8<ͻwmP8:PT惡jVX}TjV 6 w?WY,O_ʷ`|^kܙ^[X`f( fEbao$riv嘠 _7P{}RuM"Og1p2T2\K Krv" ^5PL4kHpcd2]X䪃z]BQ zMy8zmVG_/N>/x[uc6sk`A<3PJsB-&K k̳.#?J5 x~$-?5ǔ~I `chαxd+]BR]LiVҾZiv:xxL1o؟.܌vGcǥaQ-K]!3GxI39)|CZHSH<؃sUx9OVxQK)N;_BFo uTE\I7C#6}':+E]n|鐠@EyGuH<u˩[}'̌ r+F.~3zƳ^Aܛ{;;gFp˓N{(h6K-j[, [U'#8>_O^񦻨4&¬(y^8=zj+&5_|P_kϨ3ٛ-S>qJ#>/xTRN) np-9=zɠf'^Ccoc^[;%, hgЊ>)TFf6ڎp-u81TėQ=ѫo|a/KmGO@56#byǿ%CIRX=VNAnŁUMBߏ5 fe2U N; oz/\kp&9YR^GPptO jm[>(-tˇaiZ>T 8zVuǂ_!im341ܜq qG@:PQ^2#>/xTRN) np-9=zɬxV zDn)lt'B(ݨVӨ(((((((((((((((((((((((((((((((((((((((((((((((((ge-f)pG5V_-Ə(Twt!QKsz\NP[jc&pU{5Yw_?J˸ϋXy8\]jA}wb3jt'}攚ťXYI *X&Oj#0rIoxTMǡSj <-GE}&(aRmbsMml?۸Mv챓ɪHR%QV7vÎdeWUQ$X1b{?_θd=|TuRƭۆ)ğ;d {\nfn GߊLoCGk!rWV%7YvjZ߫;፝쓏t와RGɮz-n$ 57Ajgci<ލ~= YJV_sNԭ􋟦yF5mqfܯs.ץW৅U7g&' KR,(xbX?.-&1cPH p9dHυOuK8k hae='r}+|?2/IoRQҾ7F[- :һʹbǕ˦ /-e, 6(ݜGl,s^ '[7~h~_϶+(牢57Yd0"U~w?s{kW^! ='KO]Ew|>>У3 O/9ݑG㊽4H5mb;-|;b/_AJxZG_y>|(Ѭ=J@8ŇǨ9וkv>4 k>m-ظC#'oSח|ZӵxFJ2|AڽF]C+ FAZIu֚/lcLrQ^a3xŷ-~]&ooa.s?l>Ѽ2)X\J${ D?ѵ4KLZ㈁ `g-4~^J+{gI#7lC+cijm ̪zOQi'jvowha$~294ד|b?U5xgGl.5;O>[ m$fO1.@=~T/@/>d`~+'?}KmORu+Ho$ `ujjWR3$HW]|"}Υ.%aO2copOOTcPeҮ=92;K9|78Ksgu.Dr+[Ur:~vK`& nny'>+յh#Ɵc;|.Õ y?h-;V7k1[iT+K.@hOt'E~-˿?nݏlⷵO hyYdmSeNp^@i-N#{_Q}E"3X{}*o_@gyQmlZKrT+]G:t``\ {ZVi'SM]9c#Vy--o}t]Q+*Q_*!< HDXmi&yR(׫5cK][Pkm18=?O5FQ-D2Lńc={&|vVi$zI4S%fNjve%X-충>oEq$[X Ѷkὸ𽾗?o,d͆.t$,0"SKXum6մ> ^#rE)($BcnIt%ӬcIgX.fid9${P+ʹ>Zkr^:$#ʚ@Ħ Tt{חWV%pEK hʼnbN瞴W)XM/ñuɨ\h^oaV9w ؄ cק~h59s[iwVi@FN~udM=O~malw;LдqG"]w[-,g}ݜ>PQ^IkwQjhO-.Ф &\z1ij-?h2g{=V!nP[HJGBJ:+ɬ.5Y1OU4cOu9I];t0r9tn|Cᗳ5jɼêL-Ԩ x@Ey>|D.썽3[o9v/5oƞ/JE=ݢͰ^4fՅzE=ͽOBGw1=IUoU}JOӖH0"o.]~m9kg3O?3{wsX 9vb}C@F QN=ujxfm..MlHH 1MΏ)4^XaȍԆY epwHm7Ҿ}m]ONm"QlFI$ V[ugq6FӦCH³Xef;+θ&ѭ56q$"0|@Gr՝'MɧA$^vvCQ/h  x J7gD'9?ckZiմ4mXxdPҪޠ+zZQBCy]ϯΉxcHEHFNdVA.B@JvI߇1ꖒͨ{ u`HǃV|d?#[K{m2[{i<}Ϙ{ =FjM,Ke$%)YU+sok7E%ĺuݴP3ϵcCQ4Wjj:LD .5E:ᘾ H\W-6dl.Z[]<- sBIR98=zZ+t{k6cUk[TLi/$`O(ܨ} ]%ռ?W6ڍZ\[^\Ċ[%pS0zPeEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP75O6&)|P^ O j>/#NC_I[>T'a}\*8ΚXDq]3ln zN?_c^y=47 p"aSY:mi$_K؛*}?E&[{Kyg$jXʶ[{$-=KrIx{Wg_dIfgiy_oY*fmԠ{P?)*LB{E{].ugĒa{ʽFn:tӰt\]<"Z̭cck%+ (8Ug՚(۱iOEG"K7U'؆Vi|cԵ; Oo*%iZFr$ErJm2Ks{IGޛ?w|Ǟ8+ i'|C /tYYpMl@-*Lֵ,) SuOZѥ<+,Q#8 r: բ1.|-ůG3Nɭ.F!(<ʖ6V:<#Rfk.3>P&8`( Vk-Ƣ1Z ^h]V Xz=N=FK˻>Ȳ\~xQŽ+^Zvqyo0 +۴}S<`'bm&y뀫-ӆz/Qp5EsiuZ뺽S[DyLPx1 [HA^_jr6lgV'r_0u AǪZ}05{7nF`~U>m6KZkKt (ӫ7k@'l4k|$UG 9$ISMt.KHb2ٴ`ֻ:(}/Z gY 3I_zڀp(5a|+azL4jRM%{48pzV]xJӵ+nfwC R`rz)Pߖ7[DC oTr1]%E5hךΩ~֗kw x#>T)}5<>m]7aY#JF#(z ڢ0𞘾:im|םY#.efA֋ kè]j n)C 6Ъ$q Fy(((((((((((((((((((((((((((((((((((((((((((((((((((((((((Zel*h(-'6}gJW66v[($C@N==˔QEblQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE endstream endobj 10 0 obj <> stream JFIFC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222w" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?F>oѨOy'7=_5{jp<F>oѨTgdI=_4yWGEڧ?=;"O>oѣϛzj:(?yW|QGgȓϛzh}=Ox{8vD|G7tQ3ò$}<FmS'7=_5{jp<F>oѨTgdI=_4yWGJ(?p<F>_Ѩi{jp<F>_ѨTgdI=_4tQ){jpIK=_4yWGKGgFΗzj:Z=Ox;}<FEڧ?=;}<F(UgbO:_ѣΗz?iRؓ͗z?h}e{j{8v=4yG2^گ?=;d}_6OѨh'Η͓z7LoWFd)i{zp?͓z7G'oΙEޯ?=;d~tyFRp?͓}:e_x{8vI|?ߝ2=_x{8vI$~tZ=_x{8v?Lgac}:<~t){z{8v?)i{z8v?MoWy|~tZ=_x;LoWF~tZ^ޯ?=;o΍ihv~to7Maѽ:m{zp.~to7Maѽߝ6g÷MgM_x{8v?MoW?ghgð1ߝ'oΛE?oWy$~tE?oW?gü?ߝdoΙEޯ?=;$~ty}:m%ޯ?=;d~tyF鴔_x{8v=͓z7Lalѿ:oѦQOTgd?ϛzh}=Ox{8vCF>oѨ3yW|QGgȓϛzh}=Ox{8vD|G7tQ3ò$}<FmS'7=_5{jp<F>oѨTgdI=_4yWGEڧ?=;"O>oѣϛzj:(?yW|QGgȓϛzh}=Ox{8vD|EGEڧ?=;#R| ?#Կhp?r?0}R| ?#Կh'>c }R| ?#Կh'>c }R| ?#Կh'>c }R| ?#Կh'>c }R| ?#Կh'>c }R| ?#Կh'>c }R| ?#Կh'>c }R| ?#Կh'>c }R| ?#Կh'>c }R| ?#Կh'>c }R| ?#Կh1jckGTj_?Y4Q1jckITj?Y4Q1jckITj?Y4Q1jckIT/$OVEd?~ژ/?G$OVEd?~x/G$OVEd?~x/?أ]O{'E87~f$ڧO(T~dQGN|Aٯ 6=j?جz(Ϙ?_{6?&?߱G$ڧO+?p?r=Ǣ܃O?ec}S{'Odb#>c}T~?جz(Ϙ?_{6?(߱G%O+?0? c}U~j?جj(Ϙ(?_y F=?(߱XQ1Pi?gW{'Sdb#/1Pi?g[{'StbϘ(?_y N=_JuoV-de? c }T~?جz(Ϙ?_{6?&?߱G$ڧO+?p?rKsZ+4Hٴؠīunf?y$` GKcKxw79㎸JT*8HieHe܅QMOiZU7yW0:n2; jdЅn|BV-UȽrEđ1#Ĥ=᱃zӢgEUWA)'vֻ#N`ht5.!Ę%GdGz7ouzmoQ;A?ʮk5QllMז@dwUk=#O_-]-"5AqQXWAx]Z[h!X|xV%stDʃMMѯs?FJL.qXI_iPE7\:Z˦x7!VӰd1U'h'iٺ'Ri&nn.#VE6&rH~CEdp+;9RXS)wi[ixb4<i-̻9>sׁOyWs6UZ2rvr? lb:Mm VbIՔ\3.Wa+i5Yuk(ec_8[^hkfm+2Ս9 CJmcZ/*M:&#HJ(纍KU}EeqY߃'UOh,ϨkQi(mXcT 6; SmȘr3-HثTWgXZYx2SFӧnӪ#qNI#Vt;iyo$ı:'T;F1*}^Yْ5Fr2Һ"j+D- (VP0}I?]ߋtK9h],\s{Qa{N ,uo:C[C;ªy{.:giOtr+;(Z-巷HeH P78hB/8Ѳ Su Q/͚d t +:/Uu  [iV YaP2D{jZN1jx%6T;YOPj֏OmFNU$('[_YKmCjA C'+Ӭb.hf2N"8%ytU,4ǟ5(_}sğgvϭT;Kck[oSS=qս$VW/<4lLGnՖ2pt vX=o+ѢԣK}?L6B %#@f8pkfGaX[I ̂&;YА  ;;p*F(Ͻhkvz^VŸ6pˎ0z=tټ:|=ei:uu$c{=Qv5]6mU6;FIR}S]_kecm;G1/5ҡ|ðgN*ѮX.!\a+g{'ԩҷ3[/ejzwZZmmgp6*Zeg i-Phq!YѲ8aLJmwQ'>G.'QFIK;W,e]7E\ō62GB*w"oF X©HGw6G5;=nl>wxa[_),Ddp ~4*+]ceoufڥh Hȭ t7MD a2 2=iMl/cw8+]6yMm5[ .B QwMrh4QYvFw dpK tllsw_`#UMoQxw$:TZb iR'RN[8ܮOpP4V:_ p,,^NOe-Lx"629kO"qW{w72eize!K"2u+]&~$oa`v}4݌Iu<'ȰmK40/5Ќ#ݸ{VTGi LH#XXסɤZ·wwQf@ d šL5(k-B[o:OΩlO&|ͻjQWIw8}GMo^*t`$ڪg.+ז1!Y(nLgW#>SF%Dd 9 ӯCTy$zlAVx t @w<|1ҡ4z\VQ:q]EJS$ v۫9b%=]G i&x&6hث#5zU($ecgvER7& & zgZt/{oU'8'#;z?V/ ڭdؼ >GYfZ[֚a@;S3Ri\F,rO$RDL#aQ 'SKP|99ѭuFh2H31}jtڇ.T𭇊u /^0D|瑐x=t~G&Yd ζZIr`kx+5+rO@Nk?VO[%^]$\NRvM M.^x^weW_VҧF[H:w88NmXƏYut/^Y&ߜamp6xRlS~&]2C%` Oy}4)7wX+BFYTg~U M-yެsɫWY;mS3\eycqշes9rA/H>Р\FW;n=zUK.у")lu5K ,+ 啍p@EuO4sp-緹uFC+G*Th'di:bvy5QY4GJҞ5 ") -Vn(prD$aQ{,Q.ϐ(ĦF3wRqbMN/IJo>h1n#)a5Ap Dp R@w#tn?kPG&E1L6FztkmGJ4+QCl\|[% s7 JrhJ _ՌMxmI &Y<2e$iw1ꬤ>}-'zWF6(pAaGc?ZOj'ιXv\pm_W+8iV8G8UQOoT/[ϲj6 XNԿCs sd -#~d'iuE7_ 68nZnv~Dƚqw9Wư4h2 hr*{,m1E2Y$XL˱ 3kўSk˔p ab .7İyrҬ{6%E8ڧ;_uwe nRA)ڦ{^=BP FGBkcZZgKcYc$X=F*ORmvdJQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEU#TFmemʲTciVͼ:HWl*7nyRZk[cN%3F ٍUzGdK.'VHUD. 1׌To=ABn!k"bh=Oy%8Kg BKs7Ҧ;1t=0i9QcG*y)E6Vv]İ#r0X@x ]C|豭ԑfUs2>G$Fu$Vtq8LF5Os3a^ޕE6w%IcxQ:ڶ2&)c k (צ*+MLFʰu,I{tj)rDi>P\;f7˲ܡ1HÐr;}yapAicQonir1%+29R'44bL"dȔ$xU+i9pHj) kjF4'[>iO~pivĒi:}Eʎsv ӥfQG*%wIIV #J|a~%Ic4wu}=z9#~}%֮WFK `ߴ.:YO_'$oM9}k9PxXl'[6)>"Tn^ttpQ85E=b\ji"ƉQ`(UEص[kI]22DՇE9&]ךũ2ŻS# cOUաH-6% sk6RRMYz!#&gf cJxP4>aȶ tny8}+&|yZ7ŗjwד[J,7庨t`⫲Qƌ$|aO5E.HϹxcRC]OoͼP!~zɩ/HEƷr6rX0?rRpMܥUߓSzŧi6Kse cGAҳYk&Hl#(%rO9=y4SQHROFE5hXD[Fa)$Av<G?GJY_.l.y I{cEs4sߛ l//r@'Ұ衤d㱴(ԦRs@ "cT6zt|rJ&|78+.\~W͛}{ՍڈLD&EJ,x;{wU ~brI({gFc[Jwy84QM+{hA\[wzB$FT؃郜c(j[#sIaoi{cgz-WeafW/lpo&IڛJ@zbʊZiE`Xq3Վy55qtb)% TJ=5E;+X\,]kor9ԑx5n\=>(-Q߳ۆόnbijz+.,pRiYoYZݣ)p= ïcVou뻴4ͷA!Q$=9$]Y^$^s%cI"*TU5$M#M{7JOSXRE{I4SW/ssqgopݮLQӧ3SnuYy K"QG&NrykOImaP1L\)OZωe^!TH2UO9r?gޱ(7pRiY/YVBxrD%pFm(5V_NϞK$W!܂8)rDi;Ƶ-E&@e Ӛ] ,u7 |> endobj 12 0 obj <> endobj 13 0 obj <> endobj 14 0 obj [ 15 0 R] endobj 15 0 obj <> endobj 16 0 obj <> endobj 17 0 obj <> endobj 18 0 obj <> endobj 19 0 obj [ 20 0 R] endobj 20 0 obj <> endobj 21 0 obj <> endobj 22 0 obj <> endobj 23 0 obj <> endobj 30 0 obj <> stream xVN0#c'j Q!PmEJ)K`+U~*k*;$Q|RYz/+~L,XHCt5ofݥ·zZLկ~x_i[~yPo逫m9b i9t/Ȑ endstream endobj 62 0 obj <> stream x]Mj0 >dM),C,rnB6}Y=uw'Ǹ-€'UWM{Wn;$;j".78<0o=Mpk8#%TۂQjf]cDi; "©o.XdCjyj0ګaq}sq߻+);(ArOx[S 1So& endstream endobj 63 0 obj <> stream x}|TU{6$d& eB iBIB'%B"hlvWP'J@Tt{oV(9 DtM<=sϬd%bʼIJxn)&A~N^-Iek~θ\E(l?͵QytI ^='rB>ߐHZoD8)cuO 8@$PUVϯZ+yȽT/[j۱L7[4k!D3VE9fU-YDdGP{! 3u%iEo#aC#F\0%d_ߨuνV2y8!g0Ր2 РdfZQ(i1AtʹzvSOsrf#yh9R3ExӭOt*h)O[Z/ڦhKP$M9Ufsu)M/6~^8I3u;^}S3NTnrڦtKk>e{G(%x$ 9" n7~IIS%ZM NI' _B @le_ib3 J RCߤTfz}sC^2WܞP R4 );ܼ-Ϧ*};- )C]TBz fUtDƜԿec/8CxHFiSviv9 >㶟.JY&VJ#B꣍8eJEݴQxg}E"` SoƴCU6T6(ȈBL׀}*wh῁N{IӍ-` X,` XgL?ϋss1Y933` X,` Xv#` <,` X,` Xi0HҀd'qRKmH`:0я@ R_wϿv,` X[߀-GJ~yb2i;'璓7Tu^4FX*&eV&#m8}9}E!II}' L4,iDR[[lh˳-eȶ!_M>[pіzR:BGh۴̤,5򄶖V֣-B[wßj>ELj+)G?}i-K }Ez웹jߧ[Ko[_ۅwu̦tm$}Ǜ0cm/&zXݥ/z_?c&F=(Hʣ|*\WtD0."YŢBLsB U"qD\&/?Un2 S)j 3"L(SpbE,]FZKF6.iS_c 2ZZzR'ڝ#۝%^<Št )I)ۏvzyN9s2SdI#ƄׁyBV)Z?kZ`W *]k,]E ̯7wYu53gL6uJEU6x]3ʙ=Ç 283oiݬq昨А JϷT2mcmViF:YwB#"6FImQQ^g/yzMiF" 'γyD-SlvS~ekϵֆI(OOfs03XFQY_U).qYRR uys=!F]9t9}w%-fY鈬TMu{*jyb^q;5e˯k6;语~jr. DcT j 6Z{ϐ-&ڸEE%nn6)┇RZ.EV#=HK9!PeejIOY"(rDG3aOJ)eXUv, Z|3ΦEa]4 k#,FKݫ,+dH*r’fpR{va۫ -2;;lx^MzS&l2!k*E"Ԉp5&a[PTݢ  9q6n1qSE e_#GG",sv^$dd5`gx3Ԣ4Ltyى0A[#E4R"ÜFMFDJ_1z.ZUx#pUF7ȑ0q6!Om5[Y>\g##ɣGp{m'ž#ҟ`/nt*؈bdtY+sd9P4p{xEhJG{d?eCR ˱.U)􄡆0 (0Bx֪솄c!u)7֫CcY0X4֎7*b)Qrnh$_FM*%)MYm% $pLg ExVZ./FIǖℓJS]U=o܁xeMeC&{XFiXvaG:y5,vZa)/M>ҁmdڄ-xɕxU7͸U0 2U80,Uhzc.tppQ+zVc=IqãuB(p}Jم^'*,mhen1ʢuø<;Ŀm{hs~Qg)3~ȥ ~ ~:5w> hj'( >;P vD17|%S\%8GJRbg+BXęJ,SAJ,Q %)PJW^yJUbDJ(QL%TbӕT%(QDn%NWb.%ʔD%J+1Q JWbEJUP1JV@|%U"GQJ8Vb)1BJ SbYJ QbJ RbD?%2D%ҕp([^JTiJ*] ݔHQ¦Ud%誄E.JtV"QNJ$(DDf%bV"JH%"W"LP%BV"H B SGM_8?EICJTG%~P{%S[%QZR/\ϔ*O){XPx_xWwx[xS7x]הxUWxY=JċJJ<ijJS=5$=<8}q} xx$ և#XwF.Z?s*`%p68 X , `Xy\`0@ P J`0L@9N&. %@10EX | rQF#0`(  ` 02@ p^@O; HlHtN@@,`bh "p B` 0 8 ~~~~~oo~k+K s3>o'^c#C}=]m-M u5Ue`"<, 4$W q`7( x ZC6`+p?p    \\\ \\ \l...6K&"B`XC5ֿX_` /ֿX_` /ֿ{ { { { { { { { /־Xk_` }/־O˭?݁FK:IK1Bn&:zem)ӕO3|hE!=N忞iǎ4"L|}E\TGg}sWG[;PQ6J{ ar imtQ>p栄*h MiTIU;9yTOiZY!5Q^ }D[p%ľxRoG|?S=4mo#%kt 4&55.)% (N p %!r1&-j{.g[vzγ|tdOƑtq@d|G;4c'o|ҿ%j{=fڷglYVBףlG===T׿\ĦBBj=8`9(-Z3|q3Ri[>Hڞ=y`Pr kb>#R͓A!=t+^HlR|BRI I!G>CP_7çfwׯ L-ɉ{O)lhM 3oꑵ]e]㹮#1va8FiŶHgow" "pv*,Q5Ҹ:{T!wLd H4GjlI\A.0thFƴiB4;?;g2L=Xߺ$U@-y 롧Ѻ[Z!oSbjT5ci]RcD:Hm:[|,8-mC"υE- &oDtD?r3|>BA__o!2 <,Yι5,[1Kb$.6̠/Ξ]ȏw"?>>"]t.epN|&)m VD(i[#$kfgԦZDn7A-"9d+iȘq+`!Wc(k»qUe%!o=6 k).dO閖;h܃xu1f4 k3 ߩWN"m Q3! @#xs?H{سP#,UX*,K |Fgv!"BJeFwĎ>BhD83 ڐJ8QQ9v֎"plKGbIF(-ď2 Q*68 $0<ߪ✂w@ޥ@_a-d} Y_/kZ.H4%6 ^>!g,.ъ~x1 RC1_!s!QB.y`Ȉ3k H;+8=40 ^uOV(,T Ƚivk~+өBBmUp jbχqo8^&zYKzYKz9裗Rx ߟՀ]2#-GbM X~jtt̡p"D 6DEZ=Ge18Q16,j6ʗjtA!`Bzağ\u;Ű4۰럹sw&O<Amh\qѿ|cx;s贫K`Bա%dκ\.a8!/C.ޙC} @LDŽm8f|Bb1YØCL!&k!FK/0jnQ<ASh'Y$8I؄d>D|F`a? [.K?,Hl nn]$<(ܤxSD($yk* yYnrW5 A>alj?$!տUJϳ,o3i|`;5(1<&G^ ]sI$Kk5ҚdiML2Q9L)W0rH3YK10/ 5:ks)pH֌hn}VB1uj :;Xòj0a!IRcrMnw dڬ^tlƃVS=! zh5MRpqA^0B>iT$T-<ւ=xZX7jGzS>@eT{ªo-pHa!u>L`C:jB˱$$Ngt*2 fU&-P >;&Lv'AZ=> {\6R]b:2Bh!3B*gJjLfT^,5[V[Ƽ[NSn9MeOl )*RѢP/S++R1L{C_}ܡ7=x _پ+"U_ickˉGpd>y߾s[nz[Z^"o *eQJٽ{+eQD tqs:`c|LJ% LB#A)"8?&.4ˉ UBvɗ3;GT\7Uo/242Z.$Ж5FtϕwIz4@/uX1B [=Zehh95l [@^V /+j3x&cirO-rCWԤixN3-uh!؅j -nRK-ٌBPP9hƠ3jM7 * {pcMڛ*7ޢcKmmɇ H[⯋QAj-j4hEtb>_R/͑cWRl1=l.ǿvY3De&F/l!&Xq …s9hʁ S6(}xVX= pmnv" \[}`95(7AC+m  pťB:!Q#p"W. pvTz>hP HMHr./آOoihaatɥ;r -7nJ6myxytYPRКXvniʞXƭ˒K~k2~i~ISMu}UzGV*lgw-iN$[HϯZ3^ޏA$) r&HH/FYJUMBI̗LE/"QB[rHލET)Z)R <bR a酬  Xq,#7b,,,,,C<~ xOB^ݩhOaadmh[/gԮ3^;R)0n]{`iH=ud ]uʕwb4Xƚ{ 5㉙Kg32p#"Bp"!u]Z:dtTFKKTl+tv b?R!,PVK ig<`&! *gY0lVl1XJ㶘[ vd8 ϑz1X3/hH}†4$ʌ 9 Qj!ttoXkm X  }|SʫdUsV 9MMĮy5J$߉v0%~:{^^p4AVSWI)ܿD([[ i6&{4.{["8Sɫo8+j x;+`] ڟ;rS~Y'of.<L9ώU:bJ@c99iBjZ њQ1WpgpHYoMk[`9>:y9]G'E~8+"8>ʵ:ƞZoZ(>8ijkYo6%mQ@)Q| hxa8182RTmgJYےHaPp?,j ~8`7ɞ@k5GZ_Uo;Өh[YfXcr8axTmF A^wx촷Jt˜QtsMbJdusn\8'*6-,W/GnG|ɃU~]λcMNL|ޟ_%7fTyY|cKl"jaJ9%A\(Z0&Za_@$9 oh EǯJ/ +^KgR`pj4Py u;nټy]PW1^꼈ZP)?gm&]v% Ef #yN'1M0؁I5 /&OS ,mG[3X~hȨkWÇ' ķ@HhlDtB#<8[ Z<ń%-ϒ7|T7R8xÑ}ܿxW,iEQM/88Uj6>l˓3h]}#xdb*d <5m0KDF%$*&ؠ$ o.v,Hݨ 52ijKQ/ _^1?Qؖ%{&,(wdjnl @][p/; {lOX="5\ⳅDG} upWXj\S+]`ATl)4~?u{ún{<8AܢJ۽W߸4,gћ<|)C(į]Z w)@T yjSG R;AGEj|{Zy4kNEnSgx,/Iz {('W@2*6/׎W5+4@-6t hxQ/?/[,ُM ZZl^M&AEky t*z*}VkEqyFGWSWv}ϟ/TVFoW.?`9,'/Tuq{cF ޫ~20e)p/Чjfh{;h{3G}W}>}~xIWCK_zp#bsf#c{Gǫ0ׂ e 5P$j(lهqvsiUaCImSK}؃ -dŵqu?j56OZ?\j*%&Lz6 EO}d5FeX[rˇz`8-:ޫbZAVRrDQd6$ ֶY)BkRYrDNa_2c>i]c'vmj(ޮOѺ>T{ ݋\*XnR+ťk,6wlDI8ƥ&Lj(?ujBIo75YB_U|++ k6oHoCQ>UŚTRRW32gR`=@?:qT_L̗h] 4RJkE6fQ+NNgn# 4Gmgm1ԋ/&.|bwKz ӡT(s_vt i3t9"EtuW 96jЊ#$)CIsb:zND jT8`mglZc:ą%r TumhDVHS1FWѪHP2VvZn483qFQ ̑P%VVОْpf^[9NvTtE[Z__^ p2))Ǹz}Ec"f塚v۳U˿2lvɿU(0wߔ.U j OҊ#-#s^BLա n1 !z~ۏӶ-7~mǷ5Z> tKf}ൺ<?v˗4$'^0c+m} N{Gct\2^,R=x(%2j5aVȌ.I37;Qފ(m+^L-DFJm yVUI^OHx Be\>-Eř:|Тś"רW0{ތB=hULb8dͬŪ- X aV~b"yl1 rҶ!m]J^*$*oA驷)Z5Sk-xvK㆐h!h,VtR ]T4 L{ ߕ)U,VUBohX9e [2a/Lʢ*PgB(Gɘ 0IC1]SzB) _R_Nީ' 'dV+vO? Cy7ֳ(uHjj$ Vg,vVV+[5od<ݎ=WņnF0pk/,LE6!AF^; "}z!j*d.!kYsil#_EC#^}#AjT)8S4)N(fgtX8ps9X<(he'l!B Rx*U^1){չ7~ VHem;֎F׎Ւ {kGƂ,/pRCb-d z~G($9 eZfK($4Qw?ػjO_eH[5{:M@2V!j҃iل+* !zGOe*f-:]2 `406iB߿6\}=Կ'v>q=&f`meNw4M;UvܴFAktZ۰;'Ǝa; =9sM%9^;U;ۆxf_7Nno:h!MI뜮_4t@pe{[,`yl @yGW ]B+kXDp*xUEs"p$bh9$*a\biJn}>5NN#|·G^7p C=۪^l`ٶZ2]a[?pd-'\Dh k/vqo&{ഋjvGv/v+bumuHV>%*J]TT .yn:fRN*!E.[>R*_O=D/P/(7B9{uuN_nv?''J= *_oCcboBg}OtГ:=)q]Xo8~![QwKk$AҚm|Sc'Ƕ~i}䮝-kZA}W&Zg3h=Y3oy_])uopHs_$v~%wrGAӚϡN*4r](ss0wW\Ex_zxOM/I)שDpd<4'Ǣ{9ҰU@ ?q!6#W Q) W` >/sC.`)T59ظQ \>IGkhUp`@Sc` rٴzvq4ғ0?ilkZcJq=Nr]\wu\'n)-r l[ ir.8! gx9F6Ή1,~J?V*1M[bZEX4w3fxR)Uxui50#G ɈEG4" ֕ W+Iϖ5׏\hV3jVI97sbf {:Ih[ۄmmQ d)7 b33==ߵ}l]צQG_>Nse]lr^V$YN]Z$/>ss"sjԡ$E(mٜ.P"g . y-eŋmb1&(|D`"_PquZRrHya;L a3~X^^+;LjZ-?k_U[JT*-}ߥUzToql'nSc;8 $8c2 wLlcfqrȀsvHH IX~ުԛ혱ܭTuUw{VH9E9Ҭ]5ԈIyQ2ۦ:vR Nk@X^oY ; YVC3z9dƊ-YpKuJ0\r3GX)/\"Ղ$9ܢxxniBŜw$[;QB7 %NFpdI!o;IjޱЂ>i^}nOõk'O S5m-}I^8_*wfqܑKIc-5|Z@k5>_@,& F@l @i盦1hi:Ie|DS\Ϙۛ.gYrRYe6X)Kװq7njq/jWBlSĭU* l"T.⻞!D3SjVgr0J pSA|!-h_Zm׊tn=$%8!Q;gtkq5n.!ฐC#czU q tu5X9 yv@"]n$oԛH!-69yŦ&8k臆m l()jਰ" U20ʢX ٹ, ̋HkCX <mh_qNt]nn¯'ԛ{DۑD#t۵4_V0I'r$*@3a gv\-)*c}|P|C/$ʚ3bq"Wd%9aqB[ũ 9?*ϔ8}`]Ĝ |me_w*[殚j/A*pcj69rrߌծaydރ=f.4={v _\oprrۅjW4\vNDALKȝ}yx:v#pp3E D?*=1-w5(P(J3fcYmGg$d2&Fk =mgDIsH'9s[0xQNCF>97W8vɖ>*lM8FSǸ[FG/tNdT=;X.^Cȅ}6dq;C;SѺ 6CuĬp#st})D|4'#RP؄( m.t忍rf RFNkLbˤ3 EZlɍT,Bn'WS5R鶑J"jXҚȍluτPt<{ج- ` N~S;rXݹ= 魔{nW*Vµ6PtB}(+ V>@`8ǩ|HrԼͺh;V T@+İDCU 9,Hw5Gm+0Y7ZW`0fMql\ fOu ,D鯂hJh1 dYnp< k#x2`FqH qwƚƤ̜k&ՃъO"IR[aΡ%@㏩av !-kT KꞲ̮fߘxYF\zYJ`jg<7d2jё#Q50>}^8<߶8Rx?5xȑ}¦8 ƸGa $l4X^ڈH#o'pNqW=ؘG̬ rנ]kݱ^̪)f`.)>rY ?$SCTY sk$V Jŭ \^SX6>YPe"4_aX/6mYmLfj=0YjK╷a$+G%l[A fgM(KlȴnUKF3VZbKNےu9JUdO3l;:p@;oq`Bj./iteRDt1Ò4AIq?6< 19|`Bn4.EkI3 J %X$;]΢^w-5V+셠xHJȇ-}aOaf{_۾p]M`s9W#MVa9[}foICwuGf9 g -ܰw~Ss5t6muSF.=Ρ}vf [߀7 vo<$&шU`ݐbӝCI"k$3o% :ޠD-z Teh83O]3axrYÇG)<%1EOnt-mY7aM3V5KB{;j5.D$I9$"zM:@zg8- {G&z'vy*NԈ>PDi{zɁfhK^?Q XA[,:ro@PotDE&t~BJ't3-VhJ?\ G*A5lO՛_C){Wݕ?ex+,+W *؇8@K҄l^J-wKvG j $ ZV8 x1mv l?7v<C:Tt@G@ZnWꈗ TB0u5ҫ&DW` pCk iykiUMpub4pjX<7lWlrҶ plUla0.;|p7N7|%FqUbGdW=t{hhiίDd)O߫ɅW~(''PDG)(d]ZI53 Yu:BΎ,Ǔ :"3*~yg"8'E@Y'/j3qTF*Js>YdJ{ߔVk a)k"if Aype'I(B-븍k\կXnذ>aO6sH#TdPǣܘZj_a!?m@?Vn~Fn([u> a}#cd*̅I7ٻ@_v3p幑d:25S)ff(n$?h9.#x.#}h4#|8<^9]Ͼڤ^Eiihfi,<\W`ţ5 !"XI5ɡέySfj|ǐnw;u W/<<*0":-rܙ]6tVj`| :9ȿ_h3)gdHf erp zM~,'MЧǮ,#& ޯ_*B$=$0I O!H50_YC:辜633?Mh!ft½E*a?D\ ryV'B<= @Z@:C#_;;{`Aww`0CHa|gu~X:z{'PIgܳlJ$P+kGD5-rmb"j\DbCuޮμV¸~#srA*6YJvJ|ޭ.7w|)^u7rTo6'moOD-KҳnD!Qui8yZꉔtΧQ<vːːEt~) 1h׮K\YT6uyt:G8VU8Dec5˲,.-ʔ/'aZ_XD/C+Zoc$<$%nc. Ѳ&=m!(&87R#TJ@H`#e5Vj ۡt?'XA [e.kx%zBy f3^S0=̾.*lZ= @r#sѾc 0P)uYU aV/?߼1j:]35Xp˓וHeBCT9iK7͔q#F਺ns=kMCޛ{v56fM'upoKB0A0Ghއ,FGдob>l8U:1=9cz~Ng7;0؇i= =whMp)HrW,W~V1_4=83mLΠ:u|x'y.L3'f_:Z ޟ@yq Qrf+UXDjndE$3y[3mfm4}M_C o9!-m3,vcWs%Y|kHGekƘRbx՗!c]H&1&tBFIWd$#j소5ד!e8[˗P<Z vNܘHLo׈jS W &!1i)jLu=ZwTx_EvQ1}hR Mwπ r}&}4 lKqՊ'c 2ЉxN,B2C]nVH;dϱj-^*CQ{Yu^;eҹq+2N՘o,x|< oV\Q\FqqT->Mh)y1K_(<6RBj'Q_%3QΡE7PRRҰN0FBDusE:"?2{mv/{ -0)&{ߨaIS[wsx{Ej?MlnDe,ATD)S|͒Еup _yl~[Lԏ?|8+Q&=[\ۥp/1x܄'(<olx$л<4~Gs cwW5YB 1׃5p#s'Xz[8\I‚B__TCĖLi()sUmÆ#CGq$.#E_iT,{voآQ,)ȿZKm1* V QKn֛5$yǥZ||a_|2&gwgqyL[,tJ<;x{.ɡ1b1"<6;BK˺×A/ʀ jK tP<(kp[jxVZF̈́fMF"!`ޥBTJo1-ԪJSJ/m0,-")3Jpڅ.i jMO:9:Gj[>uC>MŅwb*F;/ܐǗ>`=F ѫ{K/ZY0`ȲNq J#c*#=Vϔ`A "hpkK ߥ4+,@s(2OS8 l8. Z]@ğftT<5sɻRQ_!fn&TNZM|f&mmof|灐 {<";Sg 3M eʍe@TȂl]1XzZSv"rfSGG#1X DOeMgI= OOmǣ<CZE{nE{/4=e/v5#MK,ړ fc EG1s!~ hm*3l؝6&X}oXz68hyab9? ΄GZRGE(A#BMgx8,+-8URf&*C0!O!qC&H)M.e [[ʷt>a"J.QM ~Vea2eÎl A_K/d@[ٌu⪂;wPN,MK-E/;ЧTGݎRN^:i0 &UsmS56,*E;&B#Mﵦ1NIB&Jp/S@j0c82QFk4uVVعVoX]Jbim[MSC&ΰ d(B܄3&"  Pw}{{*G&ұ ?ji& #` fŲݨ*# | ]7rhdO \#H`AsqT;hAW8 FIȂi$8/|,84xfBp~7Sam˄CrYNͱR!ժtsGԩm?8nXr7X(:ͧX#4mme]^c?M(2m1ѠSit[m:{MC1ANy;cXqwL lW  l6݊ZLX3hog.4#p9Ơ2sc77QɲmFظtVEwFO/6Oxu\DP$_D ^<IW }+['x=@l"r%(UΦ5 *-?եJkЌޛf!x4; @:C[<9y[]I ٶ܃a`+L+~d-iG+ zdvJ %Zl-rp-s\[I9`qk,;Άy!IgfALc&a7M/ڏPGb,_;FR-.KB\JKV 08a.IG)[-K{MZ;j.tJ~hRHLh`_QjY^ ی@\N<_wR󼳌>zʅeյw4ԾEl\4eP6_3P~]H|ɔ߇W~56";'z ;\cyP$^h \hYy8O!.zl3Sk_83\;eJ mcчr`8 /}JJo1y$EfD못A҄HSCE \zP$4JWg$o`ܶ9a A_{tÚgE~hneJ5^Ks\M]@ȚB=uϟ$*H ik]z{(W! XԜM܆BmhvFhs/nmG2hKb$\Dͮ][{ֶ@w֯WJ&ڣTP)(N|-qPJ6#>\Jw3M6EOt( r['j-S!l.z"V#'?n:ipq.Ko>-ӼRNêRd!쬌 0O(/Hi\ǔR$1J@S*AXpԔB~݃"\:3{)+X}R5aq:{5a29o%i3њP${#݆xv;q3lޖfV GӤ(ljjm|T)N^ҷC ˯=XNJťݏA>h SAkpM$̹0~T\4(%#J!ӗ/O~VI5mZҘKϴ*W:#i-ڗQ]U{zߤ[KKҭ־mY˲--,^&aI2kc[50L%H0 e޽U,gfϪ[S{=mJieE `ffI0VϡoG%1d{Է _ϏaPҰ3.%p fH_ڂ }EF0&,egm5:<3b7? :̄H@|CM)$J'Q{Q%@a p@ۤH|+ #i^kѱ_ЄƓgry'ku* ^%d2.-:;DObaRn3$t r Qe՘\Yz3&1j9!Sqh9Կg920|J?)i5H!3)W&)ϭ&+X%&e2@U<`J9R߈yCfG{۠r(by8dL-e(dtfRiN3iBqڧRqߤ*2dz=z fE-s:ЉYq"вY!.o%Uڤƹ(2zDdxsDfu2'h(SJ$XhqRuV|+lfe7g8@Qi>A+S> c#ٞ= GBy?>>kHCIr!#"8r1&/FAfC4\NCQ {d!f0Y4z[f|Ӳ}ALWQ#] ǫs{_^ ]{pö\_\-cMp@f^0ޏu}辤`meS Pe|y?6-5ei=Np&\$|R˜-Qy\vU:N+XK[ ]ɸ P21Ya||骰CϲZfd3 v;K)pXk%̬O*r~iL1ڛKxΜ g13'Z<׊Ϟ\<2V3gHoE0"SC?Gb+tMKp%I;tƽi[LD]9G_V8Ts[-n\0|Ba̷&zu.^+IQ Zt:L c*#OĨHaLUzlq :,zw X9Yx2i|3srD? @uR(G % '3(5ϣWQ~a J&IFґ72џ0Ѵ)pPA@X7E%f}`Nh8=fc/ ^r -s~}nD3&y/``! gh{0Bjy@'X3 < @ p~ 6wt`o7)T&^$c2qhUE+ !BIn;p1~D{V;pMb@fx.8}W%t~)tY4r7]ɗh^:D;@ V$8iĥ;\[w5C?q ,Q 4db*m !TMgrGb#AEݠ(hݧ ei⭿/ x8 FpW μm`oDgV9@b#Y$ w\\=̅L0,s<>"W)Hs(μ4b 1~hO ;O-WjEIC'/LLoh8Xo9̼9OÛ7o&0jY99j̴_>E)d8'6p@QL7}H+C,0fQ ??CI]?k'mfMPqf!OC_4'3Y0"-@"$ 2_,~?-zBCFo8k))m?|^~/E&ǚ򦘞@"vmUMcU+剡l8+qpaNdz֚wҹU*8RWE{9]c~Ԛz\I{ 47wdt EGAcW"maSz)k[Uj()l%%*+l=޷~T$S"{j xӮv`N͜)˂^kIw7|c-M^`PҜQJ3-[66si-cs8Bn}y'>}z9>f΋F$/Yr*u-`ZF eNѩU8.&ܧLs, + v0nAig"t#P8hD/I&L[:Gދu{7E_PlCswMAm LU{jΨt6`PNU;XZ!ᒱf`b)wbcy~kݝ&Y^ZfG_L%}w-D C PvE4d0jOHFY禐?ΰ#1drq@sRC<65ffKQnS%(hn8pND_$ cx5&"ئ~Ul2E[.pmR ̠[,^P\Q|y~|p$@IDiÚO!J9T~Ia˖ Oa3iмMB ea8t8AHtMnjiV{S[;\ ~`50B͐Z!SlKmk݊ve(vgڡpсm(6>0>__Si+=z\i > P2w~5*ulk!VeJAB+#o\ ` `0qR`"HgFg*fVz y6?Ht;0`a6 Cf2 gҠ)]7bl. 4|TpZDmC-%*Q>1/BSO2zVCxOsp9`v=nS=:( {6b1֖Tu._W> bWE_p+FݭZw.4CIxow)\RDgR `dVbYo4>QB 7nPULO ǷUl6ZX>v]i%Jno)PXW=P,?e%h"E3i&%G>kEe8ZXWDr)L=*\pm:Έ]s/NDYB%gdtA=!5|"h4-sFf<3qdT83[8fՎ&ʕĢwY ‹3!- /% s ^@h}-KZժ>NG(( U=LU 5RYs1HD*H2> 6\@#o##5E,*~6&9_H_6\$ k,ގdLP`|坥p\9XFsrJ(MlN$7桏{JPFPSw~* Ko<ynGQw+`0&OI[Jun;HR㚨ȋtq?!1x.QI24Gqʫh:x|.<oZ7OT#f<񎺣kt$zoc~7a9څ/w ?bDp)z}N[ۡe`/RBolZu˗ft軴a4u߲:%sF0XxWƎИ*8%2 8=H L/y|oy|ΖtFOR$woݽeIEZ:{o:{+vV|Wu*y JP@"E0BΕwGo7$.5qf^Ą f:BeqVJ˩X[}lr* @޼"n%cdR!S% jĞ4e!()RyN>x;[wxɠYF )b|k9rKۑ%oD/{R`X& Pd-T[%vjsMҦ)ž]vy_o62Iyf,²H >_3? .x<ДlXՃgiOBZl.3_Lj !J;Mt8H3Ҿ͋cV񱦙j/4VS]U&vJeh ҙՄSUnVrDz'vWuGh\"NˁX90]R\䦼^Jr1M? "wMg剞0oV$zC` }vΟ߱-&wRas6CɳgYc~*= $ݰEN6"Z&-T0$xd?tJ0TN=oԏejodϛXn|'p.r0v VVe/(FS!(u8_Ksќ1.+!`/҂BpvAI0,)VhQ2sXItZt.cd~NjFmQ&N2;X[ l~r_l~AYA1E"C%0-B?b֚h]m*``a}WHcKM؋1\(|2t`ئZU(9VWɴMAz:>Wda=PƳcZ} ,$52Q(D>B(\bP#`Ih/,Y+^EksjX "Q 2#\صف:cڢ}hEW|Z-W++5 YC1*rp nO7MVwB+jnmv57zڼ7KVV~jnx2T3A 3R5`%S#:Ab.g G +CG6B僃Kl*Ql9˙6XuU[Z | ckuCDggV|$b6K\=Y[UAĜ?Fj\.YBlfeV]%؅tx!g|Xx[7"*0ޫZܨ,V0zY4=.,_bn5`;o?XP*S֤Rn 648fo[(j-s1}B)Sbb§<ҧ4p8IfO?[4lZ#?Sirݥa}/tkb5Mx{ۆڜ=_Ď<~8:/><#U7{ĉJԉqIc\r΋Cõ:%O9-|Jt?+m^ +ntEnv6-vcX ~ wVǞnNP/:yNg+ꃫ\PvTpV0ki$F)wGwp kkm n"쌻\~ө zko<޷|v?ҲUڲK=CViqߡצ_fJWiiEO?\esr3{$R3e=r}r3}mGtR@:{Ƕ*͡Vimzž:O#s%7Tx>WLPx Xk?q_Fu]m%.j[[{߱+bc0جYm& LBrN28v@"L`LNO'3^1?WWw޽˗w$_Cӌg㿿N:Zu+,NjVZVj_6Ő~O>Z^0)ZkuëFiisYF^}Dғ4b|N92̚cOZO/ҹlAxSm|cln'ꖫY= ~ 0\lA س,áPXC;^O *_݂Ze"ӫϻ?@cG?%h>tG\A# ӄuҭ QP 8JO/=ͿO]|Z ͲWŐ ]imA`?PSP xʿV~ '{iw ߮oa%q̧* uC-ɕ>>VK>#փ/Ѻc^uVߥC-H HS5'5`0rSE4 s4kio5d h_EN$e%;LP(m^ XYHqRNl"}[ aIy4 m (4_/77gmF̦:HHE7az>|݃;SWoyR}K;;FV'T3k/xtM?xSOd+o'f+H">D 1Ĝ {GB6!Y@ I=PR'yRGICv' *zHe'+gxĶhQ=7?Z7'>/- LW$)`?? ot2.s8B}`W6@B{7 2NS; lAp*%e?PR4 {Izң#ӧqzg҅ٞG[ԽeԽa#Qx{)J,u]>(T,ŧ4>v*w+7 $ y8=!ZGBC m4HDb 1cUA b La@)Tdiڡ qo{0uݲаO (93 O"'hMPaOaoi:8!4}Oߢȱ,OX@v0;`Y}) X/kU ̶X ]!Bpo;d? uR9Dsw54g o#oi2Y2"ŢaB QO9 N"L՟S?o(=KK+Z@CܫήƮ'<~>M!,=ҳԓ;3ɷ^3k33ެLpj&)fQFB/}^$սwA^* zTDAV0hxMLH_NpX@~GG©xV<]25K][G-|M1#76ѿ7x-|rձݱ$)v9x%yJ GӨF*S7f 2 , /_^|܅Az\bKi5XbKF`UOaE/KOzI>ױ6~J~ ױ%ð6\%[qp,ud.Q &ɟ_# $B| E!~?~(VL U6Eϟ6Z%_qOqYp[~UdSM]u u|݃荍QIeX}D 8(^؝Zz}Ƕؖ[ż6I\x/'Y$BԪl@tc6'mY&,[\ ҴC[9Rt Q"-f竉uJ.-|oSg+65{4rd|:{頉6(;2/`k_;,! Yd.-w>šxH.;Z=\Һ/^l[0YY Eq)𧲛[h_~?}f[:CaE꾀/gzB?cg*Ƿ t̅M^U |k@\ZvՂ ZaX Pr 57EPЋ#8$);߷tIbw ZENӗ ra~o{UMNF $˕˒9vwH}dwW۟ёݵ/fwWg*MUm U O[mLWP,!1lMXkwnh?M]v7qAC-u56w\/y }~%} ,N;^agY"`_hʫK1+MS(:ѕU%+%^v 9[gr`H(Wl(lDN~7LJ:l3Iĩ8' >J@j7BGN;QVO;W%3N( E"(omeBOD[+z"f }e_\v"g5h5!grEe7.羇 c%~9B|{疅mt`1Yh1&1:6"RXV NG9#V-(v;ކ8NIa\6Sn u19[)D^P/o@{.2X 1$%gD x716'K} ڈ>⨦-c+@W7s ?S)pNp5a>f?zs=t=wLÇcaXjk}eih6ϲ.J_)]Vo~x@yߒtDƖ,{?,ܖE%;7:pi$y)jo&_}d9; aH ^M9“#Ηe\MOViMrr|\ tQfxs:殺Sin;[ X'Yv./)!.\牎C-E0ϵc?ܺz0b`9ʳ!kDkff -tn]ў ].Gm)e~kF E:#v݄"vG&6b:*PpE-O=<][{{hvΛp),Jb 0ٜR޹ֿFufyGnux9%l:غMuzĮ#8bdrImњBva4x h*vv k.(3*KvwUEgRD7[Fń[9ҵBK6S]$w͠ղ~a'[ A癗  NrGhѱ-{ǖ-ZPHA(l`#koaCcuc]k{|ޮ]KvJHܹw!Ze z27ªe Vj [Mǎ8"J6`w (n/5RfEz  jnHbUBiU`y"qum98Ĭ'*U<HCWfh@#:{aL-svo>\ $ԿQsYM5Zayb7&ok_k8FcpxWL 4b,X׊N.Ỉx\-31Ve.Ai̱dE+>N`h;d?yƲgXhYr=vQXn.Gp߈g&|/ CDf07nȕP K+ ;2}A/O{})ʁhjؒ/f,+ bF8@i 2tBT=lsW$M_(VF1.Lyfci3\iSDR"O&pk6 , yճkmG) ʒ%qh` >ԁ[*M==Tc~t/-?< nrl{_OԧD=( !g" ұHH[֘@֧zť @[@e<dYUO@N.< )k\\)pQj%J˝-zŰxh.7#YoX=}J᡹<~^ڻke F]-zpeVÙ`zU&KWC[w YW߶Zm"tYX 츤Jwwg1r{>Ak4(G`Iʸ`]/#?Bq^O ĩ(d?U/:2Yv%YXO|ujQj gx}|=)M³{"+Ռ豟vxGǘ7Oj elr[r(OΓKT)Óɪ頾f9%\ ejK- ڔVL>\ y;:Dz;$`u`mM ͷ,<*9fݫ2=-WufVnfԪjt:Ol3P )A`=#w|lCK䛘uz nHAWG Pxb&jtU"o?)aBfU4ژjQj^K) Z3#-bs&cPayx ^d# (> dl;*k|7q=~=54 o3zo/x^Esz->iSGbDxNGr=>R6'L1SO$yDi^g18eABՓ'+g#Ë&n'`hu>쪧ulGof/')'붲x;GiSJ+3&at}͍\kypoax W+~i LmR#?y&7TSXRaY@=Z] ־M_r$U]  5.'ͮ Q]5\h#7t wbrWa(ۼYq{޸qpm޵;_W6unML24A,Rr(H8iNEūpvq--,VƢcXMxGԠ[[C?iOp6.g0a`i̮88И;N`gPwQ`K :Lo nDfU>vMuY :^N'Й*W=Dh^8Ǎ,]Z:G9BMY59 hUQpeg0&8839FA~y3 ߡ~h.i"[—'_#m+H Uf!Ula 9՟P÷BH>Sf_Ip^tD2C翻rb'kx"&yTIȀ&[QT]a]"T.y#. a*o@tB1HK*!*:(.!2W "Ng6U:PezL󪕙q}MwH5_AaΣ:A`":9L[ YSC yGI>3ShWX xU3Pw-\ђ k;ZLOza~J0J@6b5y"YWKQ/:ض) J~U4HU #A:$iOV|M@7&F +PZ3|Τ(W7}D B ,}:6uoB!ϦdBPNz!6PbOofnJψd + .AmLI'#e˙?^,? ~_⒢۝_iz&>b zNزVزlL!:j̛@Д@ZO3FmXeG"> x ~A)}(ElAVOjd|M@Hl~BSsdE3 y(i$-;cz#iwhaAYۭ^SMU>f!UMVx6sZ7q3Mٿ fDd63ci!fe/x%9b4CQ /ûo$Xp``w͇(G]n}]{?wщpn͡NDrkA :.QCZC(ܐ|ZHD蠓NmA.[[`9b}v8cm`KQ\n;uU 8#[{W\D_Cd@dLnq̛}Y]GݬM.q5(sK p.l9sgabp@@)lXp*/,t/pe5|{q*tޡV@ 9F_I}r}m!7<  2-!&bxFwKrH0 6 nDQDWO.-d /l+YQ`'ZG ^!T"& 63:W@4G]M7-¥[ΐ;R.v:,&4>TH0xJrDd-A saBi2 ZI4(Zȕ =&3bgd #EdZgMOʈO H.7"y28]dh wJ7?0gѠ|׮pW]3>ZlCK8 H]\)7o,J\e9fTE~̒ ,U/I2Կ8S'Os8#pE{ȟrw,{QO5Zj_e&-amF3kpDKu]n*#[]WTJ@B"-Jguauc$ĈSv^G4Z^7/;U{J/#@⩊#@ ZcT;UfKEc0t$ jVޑE:)ӻE+WU=  C$"Z6x[UˌFKx&)}t|eo}ؽ۷_2ke5wn{|Q1vnڥ7[EڵkfKf&L@A IBBXt23I&3, Q"D5K7گ_7[kv⣥ֵ*~V*.l{$< /s9N& [*gϺ*{&nXrEQڼ9V=PfnvӒeA6\J,ܟ6s)̙aQA&L 9zir)'ݺ̵{= '`]SaLR[yMWɌKumUb|vyiUnbB Npwohf>-*:ɾtz֜UPR^]??pE֜eToW?c:gz0+R=? ˙{\vEyنe*6p^ؤ9KEፗnin}̼KI%<*3δĤ\zyйߝW\;Zxtm11{}!uo$'&Mnpr]tR$C,GDٟE+) &!x)5+I5Kze]H ƅ|˞~[jָđ-_0oVD!:eYEMg$WSޝ?2)&N4$%,\5'kUmRyz¶ j?s5yYB v|y堂Vt"dWvdYA&^ćgKv+"cJ:b3K.-<ڽfe&qTW4+:>/S%-+OP4%'#!)9)>%iZaZbt{cYGс4 IKΰ~}§شSl$55}fkq'"ܼ֔ߋG?sF""F3fdƉp"no3^i:( i0_f'xNϮ,]6/=,S۰<{aZ|\RX<´[-ˌaaR"J|G%;v1VxV\a`z {>?kZ_p]* D ϫX ivfQ5Ie뗤]P-ft!m?Ky8^ 0~|Nc!=37.BL%$~?!-JHЪ^ Uԟ O=U 2kB ]111111DAV VYO}OHxh$4V#%<6:[zXYo[(! w iMDhi1O;IF~4& XX2͘7C?0>dɄ%CT_*Yy(Hh",&&#Ä>>;o`m! 4&!=qf-!~>dBg?31KE8Dw wӘBXZPWo\p9s[4px~U3u @ث}DXLXMXGյV:>@Xy`)Osz؁xۡeKTЊދ@Fh LP_&#`eBE l&bj:!9LEu]&;N@I{G|-t"o? a'0Љ%lF %w3xF/lƼDZdn+FrL+|xX“`  #Godt*YM*v@?a?&da=0}GOpz ]ء.:ԯ=14b>@k8w!G@!vρC@0I}ح''RPn{ՇQaQԒשV`zУ-JXS&bj:} H#-FZi1bH@Z2 e -iH@Zh$4VU?SG}@}xP?2B00&dLwn&f? 4 aQ!]tUHW!]tUHW!]tH7tH7tH7tH7tH7t+@Fh LP_&f*Yyk$4V6/ wQ!H>ޮvۀ)< !p8L?L?BksZ#6Ghm9B:Bksn%2Ba&00# aa<G= AGFBa1a5a>}(2~<~ ddth탟,!T>xq7٧%?&Q9ʟǀ aa 4 9?pp7E.F\bwQpev@xdy`2a"0S}faMwӘ{:Φx?3i783 ,1QOZk%B Ъ^[X2kc>i1|Ә>c_<. 2<3{@ee&Ɛ_ \}x\xvv |89(^cX)g0 t1#t1#t1#tHKADЕc.!. xYXkc'Ob*|#.:TGExOGr4 *MD^]W+ (9W0^Er"9W,eۼrQԎy9W DORD(^-rvϫGjyQ!@TDoѼB| `+UDUQ@TUٗxg_>z%<xZ~1j PUK<Ѕebo..Fb.Y|@=~GW_8z s_m9hL& AB|JoG8)(an%5>>ZXWo۱qC`Lv5zwxa,S4v>_}<1k;,rfq5E|]h;'q{t4>IIYS'^<~-/@(׼rh>cZCZdzd+oR\O4EDK9{*9+uz*VK/P>Jg:y>٣׵{|4\-NQcE#NOIE}7( hMMϤ[/@{* z9c1V`bD޹"RTnbKezSZ] R=h;o|7 TE_<wU8jЬkmT?vPj59{<ʻXSh6o(O5=O1p鵄ƌ-+!s-a :;|؏JNI]UΈ)48'εL^Kg<G*uum:短V#TF W8-} vfY V'#Zv:j08F3iWu[\R9*aF65J}(GOyvAmhik3QxU3wKaqUnJ8▹rxTOW ߛ0/5o(*b$&=Vmg~W8!o&+&xWn+ЬH[J3m=]MDer*^q 5_M殝O+ձk+-tJw\6SSgmJQqxTQjS1m>`_U\`hVL g8~|>|m^N,|H9¶{ ,Q-S]c]NRp(^Wiym~[cF:)Aߧ8\=vbq=\C *9ے|p*5feيծ^Rzj3{8(ݼBNk[޹ȢRq|>```3axoݽ_C~K|d^p=c%ʻ9gWv%ClnFm>s]UA 4 gǎ:-|^: ^7ȳLjwZ~.'*%>W[AaBj{}E+T[ˈ<;f[kp3kT~czmdF/v uYf^V[gSqUZ䑕vC-G,*|ܸ;Th'fE#{!n?҂.?_^ީW ",@^ߢ]nUmcJmL ȗ362`ua%_,@M1jWo :p._2fnחV)-o/?lV9(PC1ّBVS4V6W*-JSsڊ %׹J{mkMc[ͥ *aRWPTv45W(J횦J6׷U6T+ekhĹ^ P7U[l.eiYm}m|۬RYijknjl0PPՌY*T6m@RJKMi}=MUɿƦ͵5JMc}E%:*YiY}6*/]T)$FXiaw5ԅJ񷼵Qڌ|D:^R6׶pBa F2J Z m-TTV Wl#ی'z"?m荋7.+7/z#<&71z#72}5MQ8#"10YWU!^<|]}r^L1M;>6g]x>>b'$/v|b"qMxo4^W3' $a&,2a-8P&ۑ`#){D` V|)QE&V bz6b^1K[&[bxIxh]_28$1qXG q4W#{RqT/>$uKqTJ< mJ_nH&/$i?[-=ڤl k^c;!f cE,r"=v9;*̎+؇>bcv#;`ا3(;Ξd'س${d~;$?3}~?K ~/w ~=w?߂?a{Jo ~"[~z ~;.{Q$} ~?âo"Mw  ZUZ~-{|oAE 6d{5 ~~?^s2>6c]XxW~ 6Mn7߯1, =g+h..(67;w}}~&Xx%IV, :Uւ{.-{?}{s,crDVا}&_Ύ˫ 7c;oLe3o1 v]S }WhNYZ~_߃ߗ$RIom6 ~߻OOo#q #disl-wMJkz0 ~ ;>~c,rP>o=~A{~oAz:v> ~/cBK*)~8/^~ ~ ~ORH3,i'-w#; < H q/%cćRaV~^~{>K}~O38Vg;6}M.cߓa7;wE7);&a18k&,[~[I6 =~_G*Tw)]~{ +q=*$Ai,]&cDm*8p5I_g3~)|q#nNQ =~OdI<.GIj9l\ersGmw~~ς߿c0> >[OZاaVY~ ~YWÅb(ۻ%$"‰"FD#FDD҃c"LFD1XDT#*"ESTTT4|yvrоGuW>;ϼgr }K[ZcE+RWQlyڼly:<*`K,;Z:*90Yl(9uuԂH}4 G<."*6^lk5U&^ E(G'಺h**/4Byi Fe}}$ZfяU"1i&=/?!HPL nÃcG5fh<QgqL7[ebh,+[mϢBeE<nĈPȺċu@Ws(6nl C3Þ0p&&0UI(aC NTÃG}.0]O0`zT㸒n Ѝ6/My y 2#\Q#*Ȉ3b H#ߪRP8y<*[Vֈ*%;Le9fV=e2zfc.l]1}ph/pS6D7DsuxG[y5x`3F'tCF|S.ObˤH=6 4BaHF$< {czh759`~.emU1I2ލnnl_ܵ_b5qx+Qeccc̣1)%>-Gyt:<:c^Ę)1oSHy/Wafuiiz Ϟx2~xZW9MC3= 8lZM7z993[k听4[txT)WSBRƼ+fOj5$$<ιxnXn5 EXl056|PQrBԛn0񚩉5֑m43 aR3R!.-_]%FץyD(|qkh^`f}ZT+&]ʩz\9mhniF( ǍL:x] c]%c"*m J#8y;$#@jEݦ?[Iʎ7Y*|^ADkeU=>uͭd$*|FdȠ,ʧ)Q.%!5^QGoq[G(x-=Zz5\;Ƽ) rLb$)[ȍԔ(4|tE]͚\ % K $p.? EױezyꢂW yJ^B*wxVpgdf׵y*"c8vzFtKKĎU߰s,h|z+bCEZ~yfh$6WEraA'luQg{4is[ӦM&eĒ~æh,m vV>zG,lz<+NrrcQ,ϓ/4[s}v*2ls_ɿO5Zbc܊gcbb~ 318!:HNڠ 66D9űXse7a[+ܩhx$vc\|w) Ʀمs o-:`W9YYݭj2ꦦm0#Y`SzQʲ${O zy遉ɝ:v n )Nc`HD"ֈ:VMUj,ٮML @Fu ,Y=t~촧&I9$>(bꄷ qǟ{+v5+ZTn?R~`tM'GIwSQj!s T\o*Ymj[6.U "qʭܰ""X i4!.16-3f}#nj6d^0~?C/4]s- y8*HDVJ2 HrDE?,ۅMlLL#OK{+wŇaQՄot0r TEU@w肜bCpyRjTny;Qa,POruRUYTga4^ZD3$}7(gE%uu4e> nR'tє 6?Q^&x\0 1쟈ٓ0i_ч K]BPۑ>3E/H/#C50Vsv!V<&L w%gX c8G 0&"`%<~Ȧ82包p ̃RX8;!7b(k0UBˮAWS3Xyu0 rށ*x[ wg@΋p]_ 2ds {)x ^p@ Y0,hG} >a=3)3q }\ *`6,~xxހ. zRS1 =E#FБ]F^<p>}P~Ip+ 8nKzƄaP# πθr}p p#Up \}xvWifφa0W7X O FBrUk c[*WRj&<@-aDCJحp Fo> s ^_f OXBXA%OHE >0pᨢk ."l \JxQ ׻W!|p#m; wO.n&O!) =Tn M.\N8ja7xJ`cy* &l"< لyCKJ]o p xI3Jn(,1 '\DHp%ju'M6$M،L1~Ax]W'o@B؍'a&a_ 7L)*!F8LMX@XDx-aaaa a<6N),).##ѧ!%_pa# µ _cǷp^_"ab?~T ^_X??a.a>H1Sf/# "!#'\DHpZ~aV'yU ?/#Ax9HL{iIhmQa{vHLx1Wq3,Я5~QZs`i?udxFZ:Fʟp$2NB䅎vO#rKu{xu]i;2 VG^?jj{XXߊcX~~ŴZւd!l2eb15-7x0؞"RMMRRR2/!eem){S}SsSVKmH]>u[ԃEv/!}em{w]w%p\擴{'.B֒ χro/__:|GN"Ogv@ïNQD;gzhs(EǑWCʞleG}^]v{3Q^n;Xwk˛'F^˕]lr+|\/!OPa9-vA3| -Њzwrz,eʎT@eg(;G]nSv*j!j 颬le*;ZIV*[HLag=8$걧uU]v:_3 ~t8 p&?50X+a &^^s-S6|exf}G}ʶXv (i1}Uve(;[Y,SVE,m&? ƋUʪbsCYUU0XY5F T *%+XтuʪvRSM{F<} W}?@F )5R#RJe#~e8lP6}#B KNv3Uʪ\88p[ݩ>'EݕʹEx*79Re@cbBϳkd_us<+G=c ;1:қ~;s%1T#%ꍔQ#e*-UKw:GYΔ(qSp3۟jj&8햝yڷro=2N+VYrޑynR禽vX1@Y|Svؑ%V QvKT)>S[Yjuҩ\^ԵZ{ʮ7WA?hD+wTqUGǷtc=]b{YyG3Kg)̩^cצaQQَ:5uܖl8?=ى5b6^sԬ1GsJe9jμ]Ex=Zݟ;܁'uv%ˠsU6MY5溺ZW}WRwHsA0u_*n܂juP1P8AERCӛa(AT5yAA*RVͲFGK9۴Dl+}Zmn/~oɰwq}~}7}EX ﷏Ǽ?ce:vav~VO2jWOʏSKFt+r{r333;v/D{V'2}x>᏷?Wb~@똽* H#:_|/~ e9v#s&+~h?[~ïw ~COO7ww7~E!:c]?oHP~ߛƔB(0  W5+~ bELl;%kp ӾӾ.A 879 ytus![d_ZfX{fAK6xUiˁ#/_({1)p6}FI@d;ۅ$v#nzhƶ0d>lSRΏTΏU*'*gP{Q{/SSe2"9EN-J-F-lR | rEzL6I] q'7kW5v:LvDL-j10K+Ѯ:ݨmܩ-zkk}}wk dh=` Y KE p?;S٩e +g`=ΦC`3`UԲZne+l[Ml![]5m?|0σb~AMw ~ YZddlTTmkkvkkzۨ^}էiBv{2P}~LxG(NI$'y8ESũTYZ<]!]ęL~/ 1@ "w@~9a] y'xH|~((E$Q,y/1IL'AO7y&St1&n7_b&#n,1u!9\)䗉[| \-#__].%ߊJN|)EhWCZ|+׈? q_@ʥi?h?z tg.g37ʺd=d,<~WbW1$$AWR\ H!΢c颷 ]DȄi4}D+BW%xq8 p8GŹ\!AHFNQDK\$.X1zBQ bdb"*JD &JE)Z2#E9.*DբDTDLQ+jU gm_sl1Õ.q#wCG犅b! ռW1P1H1sb~Ŋ#)F#K#+FyD1L1bdb1?+FV*FT,O5?#O+FQV<yN1Vu3/*f^R̬W٠٨٤٬yE1bdb5늑7#5)1bg2bdb-v_#o+Fv*FyG1b=n*V(f٫@1ӬbCG##(F#;])~&#)F(F>W|R1bE1bbw#P*FO1OHb_v+-fߔx5/ŗAb[b)8gkp=ćx1ȯ|o7:~os ?~ K~[˿ r;i۵XAk_/Ƈy:')L^+p%P+ǫxy5#7!-pvlһWCzO$~[?E [@ 4|>K9߻#?%z~3Uowя3_]n^w]un^ݧ.NzPwطH _i / $_MU_oͣ1.?-GGؖ'J:m?u"/7MG{T2 K_Ηc+ ,I-|Kz~ggc.zNF>*eP `6-ρa.Np "xa *`)<QX<+ϰU35Q+^%X/C 6rl 4^Cy› ނTa'ށwa>쁿^8G1OS sNTo[@+6a c]F+([v%ͮbWk6߳ƳBV&b6Mbٵ:V®gVndl{f=ol/5}CgOg}KvW}oط;=ke~`dm_F 8 nH~TtuW:NUw_͏̏Oy |p.CO~ \=p)p9p%p5 z+h(nh";E3qh.Zh-ڈE[N#Ľ :NOt]iNă#}E?_ G@1H<*چb)Fbx\OqI1^<%ψ b$sb*bx^/l1Ks\1O BH,+*Z/eN"֋ b$6W*b)vb+^o7>x[#CX|"8$#8&T|&>R_7[8+GqA&.%qY\W,ŋbX*bI,~ů`1k5f FX#Qhk5zgH{=c?nOg D{=ζgٳ9\{=^`/ً%R{^aWk:{awٻ=^u m/{_OASs K+{'g};hn_WppL's9|qrvqus:;_ί7sɹ\qFXG DPDD‘#N$FDH,EdDEHHZ$_$@$=rC`HM‘#E"E#""#s"s#"# " #"#/FDF c}1 fcw}?`fCfG;kzgcf')9ӜNuvKح3[_MkXoU8 /t./9 OCQNTg150F^-Q]0߮wfY3eNڙNa?[[=FTnIQx~#=@{Xi 2rVCZnOP>2)FSuѼ:Eu^[I^Z}$ 4| A BVꮊQqQFC!3;;X˸T6YY(=#dcoچYﴙ&=P@r6 ֬YIFjcI8?Z^5̵vdgNuh9#=hN#iq8b1FM-nlo7׉9#ĝT's;tsSȹ)q:ŜN wFSVSVwn4Oԍ`}ߴowÇ#15{MMʗhi|ufuv|7xS9onƪ{ ޑwgV=Y% n}VY}簎|u1 c8e4FƓ)c"lYmѦ)KQd*v22Mx3Lm,L,1X(xSp```````FTtL03X6X.X>X!X???ʏ??)?ͿgWk 6`yWyݼd^6W'eEDe0FSNK3}'A0j5/֠b5[~ 5-Җχ#m~])w 7e#i˧y POnyAVwH9+D6݄7޼7+f|+ƇԳO>e|2+M8~e|+o].yJ1n٧};'71' Fy<+iXߨO#Fc94Zȱіiӝh [O5lkrkj49#MdEƲ"Bd!RZŏ[H`In%}B>֗*X5߰ۿ:U7D^&P^ RըJ92 rq^WFqY e!_CZK9ZgmdBcaK+VsGN+#UH~R6j! >gM:] {%VaRMy-YaN=x\[Ҍ292,j5,tPAK"P.aK ;0 cQĺǺEC6~5/6[;XeȾg5 ;%d}h0 Q*6tfd?e[^C ؊ -`;Zdgv]h&v44NlvF1 &$O?cړdulkbNs8kw3tkT#kj Ve$$=lͶәwZfKR9s\%Y8C&Pz(=Ca! zȆrCy\!zHB)8P^|s+F#s ?Z1=q7 |=7XPǔo B=|ˆoF|5\Dǔ㢈k񹨿yEŨQKPsKQsPsu}J<OEE Q0mBW0tGND? O`'fx*Z^4}n ϗC${I@[AWʸK8y6Ȁ~6-=ގ{Xdxcm.7E/E/GD~c͵YBkt.kknai5f4 FCQ [Y߭Keu&g?gO y{do_د[mv}>n?O٧3Y#X8Nĉ:yRNiu9 NEsSٹթTu9՝mNMS۩u9Q'F^TFUBhhzTEiЄlZ/7YGȯsEpt^\f.`c ZdhSh~ J6XX^+͌']| y݇XS򼏰;avlwKVݭav }=K ,pXQ8Y)[X֟-t,&Ci=cc r^9omLe߶=J!RLpE}A}C}JԧB}Qϼ4g>g~@`44LXN)G;5NıN0Oұi4*z:4zZr-Y% TΓ{)9+#g*Ww3\<-w;c4w]nF*咜1ɷhلC4J&rZB-a-$IKܽť{{KqM;fLVLRJS?HEiHFXF׆j}ڴ^6%}L9$d6l7} c$]A84&SΕF#,I4~FF\I^HO>f!o)D3D׎LqVŠzg|`GP.I$I׵ץsIJcc1wH>CQIlh⥔Ni9eHʴ5)R>KdZV7ʹYZi߮d7{c4J 8is;[ppFHӑő푃iY,ZFeOH%ݖh:) R)RG)#%@J %AJHHH)RGJ)#e@ʀLLL) R)RGʃ)#@*T A*H%J |[@n A*ȭ #U@T UAH5j |:Hu>RH  6|&HM>R H- RRG#@ AH |!HC>r; H#F |;@ AH& M|)HS> H3i iGڀi#Y Y Y>r/Ƚ H{ }H> H' tGt#@t A <#=@z =AzH/^ |7Ho>H G#< 2G #<  2Gy 1 2d 2GF##AF AF1 c|d,X>2d8yI'}d2d2dL2GyY 2d<s>2d  2dL2GL#3@flll2 d 2G#sAy @| }d>d!BYd,Y G,Y#KA,e @r }d >d%JY dY GրY#/򒏬Y G^yeYd +>d=zdlG6l#A6lWA^yGl#l Gl#Al ;@vN ;}d.] 'fcf[-o LV; *360c36wbƦ3X 쐞Y"`XMֈdƲIl&Gc~>c>c~?c?0=`Nڻ{}=_# 0γX*l@:Ul#>dGiv]$=<:,Cßz!!$;O#$Z]%,鉳QkKHA=S9[Yh!z1gibQF=m4ϔA~1;1wM5Ri-=Y+,`<-#G):1'}G4kFJmuF>2fA)J>6/u 6w3W5Yή>΋Pץ!Śd~?=ރK|rz74\>䭹|W]|DMlx]3z#Z=d=Ճ$~(|2RNB[Y?w|>ܠ\ĭKgk`7f/țsz]*Y6uнpS!Wͼ ͩzл VXU@XG.k YgjIqFɗakVi8Ivg+J5 X)x$vD9>Ňdu)',5ii~tMJeѵծwrzG/0)ATCshBͧ[:ja w!l#Qd_[RkƓz +Qz4*'$m!/I^H:&}' I{!銣DSR!]T=pe1.H5HB ZYc8giwEZ%RѩպIcOqi0IM9OxznBc<-wiKsTZ#$6 6YL66a6zZ"WN)!ց9vt%N'DۯD:/JJseZcӟLqHhrY9)e!)Yx,9:#t4*-G2vRccƶ^mmm퍽{#fl_۱wbJL\XHg@#AGccņĆҷ=I9|*t؄Das .QPv}jZ͘ڭ+ zGfUomvx;]no{{{+MABe-QG2&=)EdQYL%dI!KҲ̔ee9Y^V dCyl$eT)ɻdsBdkF-9T9R9]ΐ˙-er\!Ƚu|SoɷWkV~'9QTT!UOW TCujPUTݩTsBTTkFݭT?_ PG@5H=ƪ'8P-RՋjZjڤ6WSR{SWAuHVGQuLW'IL}N/xxxzxB7NjċƋŋKK3eƫP{ỵ;nqy3+/+l+c-r< gɹ\)ױ;cW$e)j˦{}lzT aI,V5lzMme+`^֨'lRvKKexx l[-z˼ o[^z/{Wo;]~.z{dKCɾ/ȇ#r$99EN"X(VMn;NK'IL~.O/i<#/+* ׸*ʩ򪂪*[TeujnS5U-U[Qu=TUFQj^Pj樹jWzAmĭwx4'cq/.*{\CQgQgPgUPg5PgQgPgPgzF C݌B}<3'I Jv&yz)To7ݛ=^Ylo7כx IS3sw;}}}}}.&){eo|Z>#'ȉr'r|EFIn-_!yXG1y\^ɋwyIPUPݨ Tau*b*J UJVeTjWjjzNMQS45]Pϫ%6>LSo]]Ru5 oӒ&Il?8+l} ]530 y9Y@EHEDTsâJPQTt]b"(LH%S.qoTW8uΩ6y9@&gi<3DR-i%%/Q+:܎h}-o(ТjIwttl)ىG3rvAήy9!'Gq Yyuf<[ 2\5칖K2-Rzsށ\%ȡ~S3fd|,j l98Hy)Ƥ1)Zr8,hӜV-7ug01]־F]yEײeBwMe=ق"[39r\@ G)\zozI-_ĵ2Ȝ\ruݓdF(5ΉwxR# N#vZ0J4nawF;Y7͗[[}aA =kX2Lք^E3V+hYanYqȠTSwJ<WuSSөEŜN=*4pRIUK*\崢2Nk sڳ/Qxs?5쥐Nil궬u{?#ilmwYbuӅuavc]}:KgYt1]̺V<:]EWu k[}t=]V?L75PwX7^ytN.K9K1)ޔN tJ4p,\:[I.eKҸtJ33#htiA499Dj|>Hnn jR"T|SJb%3~oG)Q*c!T`xJc~ 933&v)7848!;5F l?䑝MzI<2ңB"Ǻۚ-,%}gx E=J&Ҭ d,zY `[챑2ȍqq.11do2l[v;\9▱Q2l suIvjƫFݥj@=j"WzX=Lԣqꮦt-x!bٹ$9ބGۑ=2@%y`3 ]-,!J6"΋'"V'X8cZɃ1j/OʓAVDUHJP ,T2KPzrOש A}Tʢ*[~y*M7< VUE4LUWȠYƨgƜN;/vǂ?r#r} 7(Kn[euPۈ?ns%n[Y#2Yoe߼}} ڽڽqD2 ,+2"Z_Ӏ-#V^&|Lgtf3s8󼳜pa:S}&So71]?'6ߍ<29;JO<pn ^ Nnٍ΍ܲ1--bxi)Y-:A/sY9tc"WqsVrkqtw7r7yMmnwM{.ˢ^snU+snyyww;Ͽg@JSe)!47˛Y2j ܄۾fcZͻ9#F L>In2\[,_GkZ&b'*{m}˝-K|K] pP0y+U*U@lMC,Q0Nr0\zT_p%8ˌ1 x-FuQ ;wmnE ݇l>]uk~~KܟVwƙ7,ZgGv0=#;2& &[O~.o}~>GqnJ{*$$T} }D*E +ҕRrه(>D**<**jTFd,TIWZQuD-jZEwջL6#1PtڮvRk[ffKAu#8{9'YsR=}_]<$;D vI$u|R/7}[:Erз[V}ꪆܫ& jEuTՆvSUnPT=Z˽m^6Go[WmNmg+zO%H-Aj-H Aj al,&@ UOnUћY۱ U'Fpu0]:0]cxQMj_u]fV5t-t9ݘGiELlڈتS|\^}?|LSeob[Eg"Ѵ?^LZcojЙٟ҅")z/k.<ZaBo1QݡP̚I"XOMelDAKBs! 辰aiE6k[zP[v|CAuMC'ttt\9rp/tbtbtbtb8tbtfH-ЉQ7mjAH5c%uݥW!Mz?c==j A=z :4:455 dk.dkdk dk)dk9dkdk bk w;/D8{>a>X#=8/ ޗVX[\qzX[\m m^6/[`mq+T{p \𵯩ycд5NlBo ɐHu*Z@ C R АꢐbHr.$$ $$$$&$6$.$ln^n^In II II III|=$$<<<ܿ II<<<|'$^H}䉐 cǘ=111њmps<uO fzy%PYFp2f1j`ƨ6f:ua7o{}sXҒ1񛑃wwKW?˕Ѯ$hW ZV 0ZAE5ZVgՙhu: 6kP0V0V)H\)OB4-߇lxnUCOaw Y]}3^'z4B7=h9-k9;EFalVel~kg(kV6uw9ݥޒ#ɔ܄iK'=#!V\`u,b/ЕW,tԏ=4 4&dFb~=Vh[#jN{X.Ѱ_֛o[j-xszwLon%Ηg84ذH]Q^0yMAqcF3_`%hZ|unOehGзb1QE<$ 1ELObxFϊbx^,ċbxIM7wx_| >OfU|&?}8$p?YʬaqO[)d0v24;m`gh9T.mPPKJppJ #@##(-<2<"QQlM9I+rIҢ4(KZ)]<D%UEU*"TT5)K2QWԥlQ_ԧbhH9hLESєJ=EO7+Ri_2bLe1ʉab#H FQ'FTQ㨒/Se1AL*^q/Ux@<@ŃA!SMxjRmx'œTWLSxJ.bD]mbu;F+RO_^8H׊0 (l gi"Y}-︕q+OR|XA2;VęVȼWAIq^Sq~Kˈˌ+gkgeŕF[oTkє5c:Dؕv-єv7dKt;Gңg\G󏤕g\녏͹mgm?}p_.r$w}>v#ys3scEa:O}ss}%}u_6;eEF1dw38.=KrZM-z>2x~m{Elm~X|K;&j ĒaVřՃWÞك8_h(< .@\JoZ&h-ڠu@vQN w,wٗGXqk5ɚlMfYZϛoY묷-@F7Gm'"A;.oWa)kJنC?ۋ{mڧBqPZHrBCyj:FV^>AaQB =ZZZz%>NhchSh{=CqiÅR+a| - Z 4hв@˃VZ 2hЪ@ Z 6hк@6m1hЦ@/m%W^ 5h{@^'赠ׁh_@ zPaAot譠Az@. z}!I>(c :t*4Ч@:t&,٠π,sA.]< A.]E+AWt ˠkA_}tkڜ#G"DFEG9999.}ȏ"#?GDF Eӥw45|"edgבo"FvE6D>l|(qȧMi["[#ۂ"/YeSy(/?HAsi!-U wh#m}O{߷'۱#KН_~ 跠@7~CЏ@?SM/yЭ.rg ¡ݠ? t?Ѓ@z3H[@G :Oc@o:"]yia7ۡa7i\z:wG}'p[̎pz>Cg( E3y<.65 EU-k vǂށ2 w^r@ޫw-/;2!WĬoq5ж8:QI:evҮJ f-mv*򺂮+f,{;e2f+*J_[6n;.m#O1F,]L*f(][3{CffW( ?7W"V(U"t?ӟsys|_?@ř`.sE2 >hDI͔<՟5f$7-r&?f)3r+gsr\ Ey\,ȥr\._+JJ$W5eV"_%_GP,Ƚfy@ayD.͚]cfGI%\v(5|!-^Ǿy~2}g^Ǿ +lUjfzXM(=,\o,1_\s3ۘ]1\sC1?\9zOޘ}1c\>s}8HX9?[4L'>JK*&G1y\C');B*NUYs $l( 4GrRۤJW*SQEU}rTqUBTYʪry*JIUSU !zbޮS%=^y_N%ʇ$|b ɥ4|LUN'r*ɧr!gJKAP5uڬm?a?O͊[?OS}Y{+g~ֿ9~q_ϕ-7WnʏX{E&hO6?ο(爵e$$$@n"#`!EB.FYlD ,"Ad1F@ŨyW+a?}}ST:zX_/o[6z[=IEO[mz~QwSQއ>>P ֳ}>LG.w#Qh>}>Vϕ;d=m"Uw{=;^]z[߭z=CgGc q} I}Z_$}~>Ez>C/gcƷkȵ:]~y)}'iO;/^.z==Kޢ[D/2)<1ML|Gl1G<( Cb'bX$,1Hdb*"X,L<*b#(*cX+Ɖb(& 'hx\*Zk:^<%6?r(ϊb,[b(/mE]$wWī5{H7nxK-bxGU=qP/qD|(E#q\|,wRqR|*>(BT/EJyF|+.D^@OZBE"5OQ+w#w{A}7~DP?]??OIS3~Z/g/ џ {F˿&ONzU7.cUɊv3_7P"ulUVs_~[v_-|u?^tӯxWE溧J?:U"oORZύӉOt5D˷P T (4U4U4*a0JF%L%<>;6+$Hdk>{tI:$RM_p|54Vӈ[M#n54'HiD n!ڤgDDgT:ɨ<6I]ws}I#nqiĭ#Yc50P"ulUVsui'k_o_|jQrr,cFEr8; Zb_q֜rv}f>ߌgh= &}T>E*RY7*.sRکf>WnG'D1ԕ۩+SWnθ$fW$@ji;Zy!u^]aѥDA;O(i2ѩD5E~ .|K$K7|םa;J;$)ViHzJZGi?o2lh_֑ooxN&:DѾHt3UDWl*˒z>I#k=%~OQQy.qVw_qiik_@xxkx/Xݯ:{<+X6 4{"<O=nO'$znb^k7yJEyy{b= y<K]cΑ7hfuT;E&:scX3_ZYg[@/YWʓ],2rs %)';s#{;*Y$qsoJlxJz5]0w3r~'PE7-ip6lOݣYdc9&]m.t0Z5ЕYG!i5$&8tGq| YO{Xi?.7Ej~ ˼+g0'ϽgMӬkZ AZ cA 0iZ͉KwkZxxx{ZioIZ[ē$onA$|r%|X0 O ֳ%|L㈯ _xs:C'[14}=5}d\սVXbG'">I=5y{ȳxp,Yɳg 'N%y`o߰˻3;{+dMrT/9uo9ȴN;!Կ򎸖aS%ufwȀ#%+>L\2N}F5+MqFnؔ/٣D69\ƞ`FV^aT3Ka'Rn;|?ȏR^*~jV-Dsj1Zh]4PhwJEFptWzG*z8cBo^LjLW|Jcub(z"F]'F]N3uf:xjffS/R\͔ͯ4{K񣊫Lils55WixsW\|U5W㵹NÊR\WZP3nxZU|m~|$W*|CNK{4j*{絆yT(nX- r[1JOטּҟ_ȷYq?ŋ? id'lT|Ԅ'VP#GmMcm[2[OS&3fjbHQou#w,/!sT5JS.&-zulNW՛],5_qU YnۻIp0'OSsE>2o-׈; jFt%TDt/|8KY _wUh➉W3ͧ~w+9Minij]gj~{}Uv+a6Om_3S?QXx +CԊ$Sͨ?j C%4Н,fAv*s OS^+I;DYCWJOVCl=LY{ΛtNuoQ>󯔋L\b&<~:7G(0[#QHeGYqĞF(sq+Q!Q=z9gK#i^W\Er.5L3RVm$#+^HR4aE/Ndq^8$mkp//4o~EO9~/>//I6K/9/?2b$C|ƍMs7rn<$7>CЗ,/ˣM, $?3KyI/O2%&_m!&y|?ߥ<$~JImwSCLrI~˧LrڱiE 1i[f˳gYu9v2bl߶?ڄ!!BFl :EKЕ0-,X;v%9fbৡ N T8H$* !! a z^ǽ1d3Ԥku|r ϯ̯ʯaaFڌ3g̝|;fqpƉ5 g}g7Y)rg6{wf_8'iN9;0k1} RxF=S]2W|^߷ pA ^[phA¨,Zp+EY0W6GMќA#EocnqFg'En9;Ƽ CZç_ĬIs0q̷Y_7m _z~Dڈ2o 7N0;kRz򨜋)iyҫDCb&߂znX &cnX- f fW|OMMϨN{FEU*#+H-{E M ؁OΰndlOh,OP>4!- dsؿ-%C@7Zm`nZGk mhgv -0=[miꡰʕIHC \5G/c2h8b>Vꤨ~#CErCRZ*2U,Z!-- Rf*T!.2弤!`k5BQ iCZZկgШEje[ eD@بi#T2* {WnԐX =mgʚZK';p8s e @? gMKZv[ǰH>e\X"T)HÒ+(+fE@SyfY 'Po (&Ϡ>gXvo+S`|rA(Y,ïYc)Kg@*kͺ D`k6{C,``!ˀGc q`%6WxYkd.| k;2ud<ܲ5:h "am X lc^TWa8`<0ZbswEAWC~m-mwBCCrmm=z+%2\hЛu(ao+9f~FEr,3FhΧ(;!u^DPz ۇ0#JQtC)mQͨ %G)P6{Q_Q_QF+~wirC9)(g0~ ޷s/ʳ9D-Ai[*P#o0ZeX.R۠Qj'&V(#or(kfL"g?%*xX< ,V+#ޫC(wp8|'S?^v*9[pW1׀Q3Ӭ%6e4*'@)p 8|ʀr7ޫo w@=#p .aaPOՠ@:~4|(#}ު1@.0f(<a`臠'WZ`x o-oE%_E|/> BGAe^oP9> B*K@}- |{.쟀jd]P qx`KcO0'Y. {;:,W!C-?heGkX4 Y,fA3ˠe2hf4 Y_CӮBӮBӮBӮBӮBӮB15ИhL 4ۏYe@.4h+hM ZS)֔Akʠ5eК2hM ZS)CO֠'kГ52bzV^+CoՠjSe2FZ*Z*Z*Z*Z*Z ZA֠EkЊehbZ XF#4 B[މ 7,ak?;w%|HnH1h(36v2v2v2v2v2v2v2v2v2v2W[[1[1[1[1%e1f/c^=u`̞Ø=1{c,L8 /1N䲖q@[ ;vh4lglglglglglglglglglglglg9s0K1.c̕b̕b̝}}]X9ۖr-_ /BK_B__s9sqqqqR߽hjϞ>K}ٕޖXIz[N\2>T`1.'퉼O ߐ7yKo T @n, xc>ǽ'?ASx+́@,1(HޓA7ZЅ B=p|PWl2X `!@(4op`w0;FQ`?8D&%{>6T w!].Dt)l[,E8<ҿۼ_ƱJpHIBqGpGpGpGhޯy"'nDahq@<$7-Vxn I-@2h tnRہ@'3p t݀@'p' Hz}@? dL` =``0 F "xX ,ˀG7*XX OOc|(6sy`+gۀKes-\?{|u_g$L(hcT@ ^eqjBkz1N+T@V 6(MIIҴ4i!t&if2myNrsyxoߟ e,5X5XzN0/7?ion*2L"+2L"+2L"+Ze)~aj{,B_ x/X:x5BC,Z7CEc"&%}L|xA.^hM4{{r)\,b1KbjQr9y89:V{^uox&dFvoWޮkadtR\qϺg)xlw]lw]Yݳg)ރadHYrP+q#%G(cplTVrpr,N8kg9 ln,E80(A)ơ $Q0L8,*+=1 GHq Y*Rqt2N8 ćB_Gܣ}tJ/8>! //ܗª/0R-q^wK@fc:NSaw!~G+WL_{YFEa1J!3Qrt[M8c K:J6^}zQ hlkve߶}4\bb2mv[.]֕];B?q'~p7{~<#X)cXq<'sśŢ~@ˢ| y.ý| 4ȧ!*MaolFx;v'*}B.F:#EE܊Bs4vOzbGala؟M&q8d+s5*1:Lw=\܈07cnO]-; FL-sBcl.ᇸ-:܏ F""E1JPq(CI 8p(ᘈI8G(iO~Ӱ4aИħi|Y|G\Jy\q JLŵ]|7&L͘[p+f"=pTK!u2} y.9 nYqrQ9O&gYarV&gQ?Oˇ:>a0ZVЪZfßx̣fGu5էTݻMnwӽt{7ݻMnwӽt{7ݻMnwӽt{wt܌bfxNGƖGcq._ scCMl}F6̏ q3~39!_+5:8oQ$[{UZ[_j\.lw՚[Ԭ=nNh`< HwgaO,sC.~aؑU!y-̈[߇X8jX1@W&{}G<_|7_߆=aj=QNF5aZ=oy}3#_~8&a>54ӗ0\~OSUj+UGwmTmR9jQsCR1K,`;[)Jv Rml`(N> Qml`;(GVQzYe)G,ŲR*K,(5D!J QjRC(5DJSRYJe)PtB0+'NĖ Fᜰ'_ k}mz'1ڿG{x}zgm>)Uѱ*k'WױFŬj]dcKة:v*cخ2bأ*ȫخ*!vrn'p0{S,ŮA/`MG׭L%o 9?|Pr? 93԰o~,Y.BWĚ̑BnMF|gS]PU>9H}((1|)1k K|cJjeTO W'rcI`?ϧ4=_4gLEa. S8P8.*TQ:Pb>%Sb>j>jץUEaU%5pcrhzlF;^v߱#X? KʋQɞ&Լ0_vqs_aG#XbQX%TjMwMwMw~NWFeb3jЌ4>,a{@\̗Ael4[͖A=h uXfŠY1hV )sy*aܿ?ux%*)U?V[kl[u8@B7zy6x2*ϱÍ z<=lj4L6U3j}laEώ*<1Wjq9U'ôy6` 8,\Z/QKǏ 3G{}->h杄pϙa<˵y\ǵy2y9?\?)|:|CW\;/ 7茯guȌo2i&YSq}دKu~U2OS%C'ďqw41y~k`y9>%SXnO"̰I><.U[y*pV9߇&9ൗGW<_5k mfVtm:b{855Tɷ= +0n `B|X܋} 5TsruWaEy0ݔnJL//|Q5X +qqBJV>#q18ֹ{'ẍ́5 :|^r^wn ?ϤؤؤgZ]\Y$}S/pc4ٔzIЭov]kؗullҍp.ܨAg}S'-1uL.yHlu/ 7f^=-X6ĖZ  x:Vӳʵr-Z,ͩ^7VͼayyIMf&d5 5 ~Qsacڐ \o>+ӟOϧV |G wSToћ}V V &| ߢ7-כOgY5k=d=٤n{)j:].rZUk;Cm^uC]PWE*+r5nE},Vc uPWV?PzաI-|4joUIF6Mm]cRoʮQۦFxiQ|TlZ٬NR&k`6ft)frn4L&Nj4L&l2(k2L&k7M6Sk0L&fjin:NS`:5N fSTj?0LvӨ4ȝ5&Ve+phtfl3-[M&Va+9ȩFSa Sj[9F7&ߤt|o Avޮt{nF]Uo[uV=vDž}9\]VϺVG-Q tԫ|k|knI󵋯KxKtD^y1su@sU|^/P T^UyUW Tռ^KD5ZuѪKUWJKZҧ>]yjKZgͫ*wkZGŎ`g{Ğ ϨmQ2YJf2ـ́d =k]AT{DGD"QhfhzE+Qe{])J])J)WaՆ]]-jjYWk-\5K!WκrʕSŐg]=)WOzS{›~ӕ]qYj>p>0<:kTNlN½QԐgi3'2JDkOZLd, cۨ3Mb)8;^7^t]o"( /˲6踍XF!1(^_wcw='œ9qȹ?$A1 ivg{ŵ[\ű[Ű۵]{е]wr]vnt]I%Ik7e7YWʍNղѿ/7˾=>2^/Kr&dɎȹ;1ƍ{.WMW_%m|k Z2oV6J-ua}ZH>/ֻ|.6ػPpqtDhh^mr&mr{{m\nr{c8),q4շP}YSdoxM}">~joe[[[(ŕ([[EWeM}V?գ²(fg7ۍlгhga''V+刕roi{/mK[Ft#y]=o_oOXFn#ym6boeK{[iF4#Vh|Hv[ ]Oqѩ2j??$9-ddLh ':uڢ"߳~s2qrt|J y~ue?< |XãY7:6a`+d'a l8om}kg\%E۬+\!_RҶٿComW;uڶz[</RRRs11~].;~Á_s#',udak+nznznznzfzfzL]L赣赣赛JD;WyWj{]mNvuq7;3w7йvv8tp 2zKvZZm{o9;rq":INJuRS~H'E:INjtRD'%:IN*tR3:Jo-9%r$Ǎr(Ǎv(viʴ\޲,TFlF;ɴ<6c<ޒ[r(r8oQVtb 2,ո1< ETa6‚h'Rrpo 9%49GQq>3q98||ħi|Y|G\p)0_De4iWc^kXױ:kQuaEᾢ'$<_7!ע?#{k=.{$#qN}ŧ<\Ow=LO ōaE;Ê|ɩ8 g{I\| <|;vg%ቒ4v{o\4K(XNNtʐ@8q0O[_8W5lhjhBX /:1 )8Gp)0_ėe3_pexL>rS¢h:n ܂F5ר\k~݅q~~<> 5\llkX?v+B:c72À 닋Qq(8ɠC1TGM99^oׅTc*1ʙrf˷X*{mBct?xj4A= 4`=D# hCWXf&,3 k=F9`oXjN,5'K͉E=iBNܱ ?#mYYPKz^/%Sڒu pͰZot-no%4*Q JhqRǗ@:Сzm^[זezm^[[ aC-szTE1JPq(Cbhbt! ,5>KOWST5>UOUS[}0MOS4u>-GGw?q'~p7^^DWљ9Zp5Q^{CWZ*Vih(89bįP ~Y,R29h|hb0+pcR|0/65\ׅ.=dvi[7oƛzݕDePi/N]o9&R47cnY0sxf^L3/mm&4hfc -SW*fCBiL+*3_f/̗icGǡ'PSô;fʴ=.2?f̏Ytc1ZgB-/ ?7Kq8jtL6SU|?_rb#^8TUk;;t΃:ASsjJq%a?TU2/=,4#p$8b-kXKZ:'D۾J\*gcNh7&4]n,UẲ97eLߔ2}SoO0Be<0,O(" ){Ox Y0s@m?NN8L3!΄8L3!΄8L1!ƄbL1!ƄbL~$8!a>o.Өa%Mi4͒YlHEI,9r ;;N m'H vi;@N m'HטטD 3JuC!.㸌##q"( # (  ˌ@MCBȖ }*7O?[=n_@?@0ܩ¨`0u:6-M `ش6-M]ԅM]ԅM]ԅM]ԅM]%n!n!n!n!n!n!n/+` %_}Oɿ>'_}[E^%`/(7`?8g`y0<}>VՇah$>Oh$>Oh$>Oh$>Oh$>Oh$>Oh$>Oh$>Oh$>Oh$>O" ׂ'uL %D 2QL %D 2QL %D 2QL %D 2QL %D 2QL %D 2QLK,K,K,K,K,K,K,K,K,K,K,2>XV ,:GgL3}tљ>:GgL:KrPUg<<܇̜ 3%I_%I\B %RdNR8O9ER4Z0Qp)E G"{d~gYmQւeP(> #B(@!x8#H` *e.U7z8WR;0> |qQ8.Cj'*z\>~G G %4%-|>[((((j'}\zT T T;t -BKݴB}I/s^fpX'BQ-ZK/{^ u{]{t;*qCy(><P|Cy(><P|Cy(><P|Cy(>-& S\c$7K^BlNYA.rNnן % 'wGdDd ~k. 1_ko=Ob.'bn(me\t@E(?+ =c#r.b֌>%f‘\%s˵\6dBt|1s7;WQ{Gʵ4ѷhq- Lf;lހ}َLW5o|Bl~g[odlQC_˄G>+x>J^I{+JGVgjYI%WV$pU%녥Ā KE&h7߃{Bq<C`&ɬbF,k So6$@@D b 2AMjlP:  A#4MA3-A+p.4:?k`4Ƃ8px0Uo218fMYzy.C:eN)w8"r'JX,O #Zɣ y,YVj[Vq/Ӕk]׊-[_b),']aEӛ-WV,]dy:ߊSAz5 wa`8FQ`4Ƃfk ^%2x5-.%`)X!kBkH``H` ( #z-kGR;Z8 ~7>ILN뱹_l!x,Ŕ/K2mnQoS+{~paP U2AM7 z: p7π5 i f׼{{Ё&{[CϤ $J)*ta&<_Qh7tʽ`0ywy]wywy݇d0Lםt0O',x\,x<怹zaJ]ڂv=Hnl ƀn0A0<&`xLST0 < ` zQn b]a+%r5\%#,1pT)s ?>?g}>?g}>?g}>?g}>?g}o2>fR3x&ffSfIf!f!|G_}ѿ>GRj)zG:Cn_ 5MMYyg1g)ס)yu7lu6@c09kaU^%q\*ns"}G~Z!ZU=k_A1\ϒ qʡ!:g;;i腖X\FU}:#}Sp̅UTdPGw}EɿOq!%^NMReI{;D}. ?SC!- j"+\C5ַ 9XfYmk&%rOjЄerO9:ѧD((pA x 2-~\Rtkȷ.0 #H0 cXdzx|;"=H\n>w25ۨ۽\`d zZ\-YƗFtg(P*1UJ$r8O3ϝnY`] αZX!-2ι1# GW'o~Oo}0ބF.E gph% sC(5}jEC]Aӡz^]}8Ux*;ww1#~ohv.;lr&%z¼!DfP{Q.bN{%DUԼ,l!gP7lcWɪi+*lڦ/f>/QҸC̬T归Q-5;=ČK-wY(?SWp뇯K^4=c uӴִ,é:2nFʹ.xbWlj4:Ae;5VnEu"8z>ΜdQmQ(¤.쟢5ҫQxJQD*V_w>gOX7/5|o?,_^w';c58ߘM9ߜoV\WM9zsH:ۭ\sC4Nc7Mӌ:ͩӒ:l}u#X##yĘmS+x9d3XpW =zO>X=^eճ6E4&xj}_₧LwcVg S+FW\'>E \\'^3anq)<& ԇc2XRY.}zjaV$F ՇYtvKLaưZk+;]Ίʊjr\W`Vg*-YVCQ1u7^s굠^K"j87ϕ/Y!jvQQC+D[h]).3nys蘭EKPOTwRkeX+ aG ;2qˍp/u%!h'=MY*q8[\'܅bRL;x="!6i"Q;yVF=Xk44댶F;`\+v]nb!|&(3c(7g<ū1W}ehdecikoc6[22̫ vf;by:Q`v5=Ɵ-fq׼hk26כ})t9|l5_7̕}'c4w/{̽"x<`VGJc0> dX)k,s-/e3&A6-l%O5RW P)4gsm\y]7v6"H^,/6K%F,^Nv0J嵲Q&^!O7rrerc*9]0@.0]|ӌw;'f\\]5r_Y+<ʶN1/XmN`A:kyܜn}a6ZgbKoF܈k~"E$3el2DDȎ0;)1|c~99`EG*Qso2RiFs δ3ʹe6k7nbFo岡$ϴonCDÞbO7ۏd/qqy=~J~~Vsdy=^$߶aGr^/7I9N)J>n%r߮P|Q)XZs\.Vˤ\nRWr:ZuܩS]!w^,U}U_0YF1[Lzв5Ѳ5rԓI+K=j+[Us5_-3FmT:fSUJ[:-Vg4ΙV7\\s\贱nr.v.z9rz;mVsɺչrX;w8;k3mc stF:Ig3źۙL9ӝY=΋Kxg3ߚ,pXAks9lMv8G)QϚ5-hԋֱfDFZs K5nezpYoۭ]w;ZpGXKQXk]n|w*wtYljqlZ۱ٱձ=F]):{nQo7خ Yo]oxvco7nMO{ڧ{{ysW׼7틽we{{Uv[CS%%w;byU(/ظ7{Vܶ;@<3cOsGycxxK{v|l|L|\~ Gǧ Oğggٯǟ?g~'ȰedeԱ?˨^Qq^+L.wIͫ)/%z-o>i_U'ptJW/%l>*Ql>Ωs< AVF F?6J=2y7x՜d6/a;W[ssN}.+?}/(_uRDYDO`0=Yˉ/zإS:FٿUzCO>+y= _Zу:~{uZ?!X?*DF7ħ/GEu!kYDנ\wm/{xoWt%qt_϶G6}}U}IڜʫS0yOg}%a?5asm 叆r2ODQ^tBrswm*?SC\!zl槳Ϡj&Я S>Gя'кh'%_]^Lw< Qwuoݡ3?j,R'WlŽb{Ŕ ;åb8'TZx)b j"g)LUSiz:P3L5O'Viz9jUs9_ͧUXMV-y.QKXj)ZV2ۏgFj"&F+XmS;XTU>L17s>Q:rUNy`&GQ?s*U%j8UZUh [؄-l6a M&la0`َw 3a"Sb;+2ff XRcbDf2B,#2;D-oSd{]"v+lW,r=Q+{>˼2|}CAyEWS;Bc1VzU"=-rふ[+nm9N<wEx,Z-J9"/`7屭OF";8ޘ~ě,ތه((y:>Q?K\|!̀ E&z5N%C63ٟʐmXUw.DlR%<{'A`sBtC`nȃuC y3j5Dbtac` "KvfȒQX7ۀ%c!KFC91,5KE͐Be7!fJKZ" sw+j./-!5ew{-!67^wlsBsnL9QpڎP#-Ӎeݣe?`:'d:2&IzXM$`='d=iܗ YROzUϲzF{^=OeȃyA.a-SB}6>K^rBsC֫^nzuC YSAZܗr_n}yWɐ

ʷI&B{\ytGaŕku$;}O󇱙ǐKzUԃoHl+Sen }׊KhU; * ?iUWû?l"֌$T~}WkdYT|mvւ[Llb(Bh_p--/d 5iZs7_7K-[]G{~i\?~3x<: V _l|`K=CƣKQ~7d%}c!GQ<oI?q Uf?]Re<&dru){۾Љ+Q c/Y?&سَ|mWY~lsӑG?: g,F;b̒XH/(Z,|>8Zg?rŠ(F}#g)|_{{3LI`b|V[=RR^Ic*cVBY~qXc۲u;._ma;h[0V52Wf )9fZ!1:s9v4h:b17I1y鉱s3Ck)x*1W9?sV96SIWs=ѿ0bqE~`=`>鎲WGXw?]YֳsCO+zFysDgWG_Sܖu\J9 X蘑yxu_P| d_)osz&qÆf]pѼQ 9HZWbpNɽःrm7%}Jx쒵c߻d׷Kӏֿt+S |_ij7/w#6D\m9,Ѯe+uȺ }Tf|2]9l=f5=ʝz8+eqT_r;o{=9CrG)Ե_Wfq[}Rⷲ]d3۬(y,1"iYҎF;KO MrWcyxSx{un!|&Wx%[ G0b!`RVTjuxkh[goXdp!8ʉa|}gޒdLEp7i{lNX{-=yy릇դ51ocjN|M끟* ;Jޘ9y :\4met2(bafZ&xj>%x~5iG6zr6TQvsJW/dE puXxbjKL'$񓬔+fafC(jcπ]}kn.+[-w{~oҳʬC)ky"q&phxsR!Zh!x. xFN7DF ;=օ%4ֺʺ^ =4cMNG+^`v:Zt֋֛ZFAtYN1;P5P]O!&PUV5K͢I5>VKRJ-WRjzSO-ګ6ڢ/gGW۷wf## s$ s]ˮeaVd.*"rʥ \}}i_j_fw嬊fe3뛕ZZe]ȬoVOfzd7;iVo'ɲb7|o-f c7k8Y1ߛuusY3Ǜ59ެfMc7ksYZojx6K;,fwS!fwS0)WO3U tuS*3:yT]~WgF7u23zJ2jÌn,ftS]MeF7uUVWau&nL7SVtԝnpkqMˌkj 3Fn# q̻b55mQwM=¼kj2ǙwMMe55V3wM=r}Ma55̲YBצ7/KI ݐjS~J)4j.UQ3TC͇)VX+!Zbr,~uXoW_U նu_ֿ"5,jhgԎWP}u! z\--했- [٭k$h]]~~uy=։[U]daKC$=B-BSCөBhF =OXQRcf|^Wx]8iN5ՅcuTlT 9:UCh>r>f6gvg;sv8;($򚄔;Sce,kԸ7e8:R^PΏT"''ggu~E77jJC+жQ+h,pab]NT֞(4X_ufr[Qg!}D麲 5 k(}ҵu}7 )stu.?Iy:5ҍnMtxE]t3HRD 59> )֧p^]uw{u/[_M5? xLmCߤRy}EǹܪoC9#0RD )YңPS߉Z#x8=0,'Q~DcT'izt=3,+yzTYNPBK]BL@J\ E 0^ gסyCHQoD{қfތK6o[D~w \[VMoC]zJ\_鯐;#{?ж8DN Q~8=A™ TLUթPN]* ק3 e8'͉ᓨ(C q14 7Al~#4"u Dp!bE9,LԘ1$0$0$0$0$0$0$0e3fJ DL3Q!c&bZu۸m  'rrFN MEO)^4@Q =PRކrF#鎄 B(E.*j\5.F;} ''QSSt#-h($$$wt=juQ.k"DEEYXҍ4"I$H djoďTICɠHf$DEQQ|Y,ʏdGHH%+G*** vh $$$$$$$$$$%1S!?[R7Iݓ#|nҹt']H+i'Fa?C_-R*9NeHc I1  Ȼx{SuJ..jeetA5{']p/z#M\]5޵TC D dy#C!_B9N[ۨ7{#(8ڻ1(A>=4h$oy{Ǽǐ~7ǽQo bzS7͛FR= Y{{y9"D9y[m|(m2V#r(#^nM9ѻ/z4FQCчih)4e2&xxx2OSc ւ Vc13>N|B`OdAqGA邌d\^qAg8 #=$ #=DG{IG{R3dYY{.ߓ ѳmeC3Ro~6,~ݺz-^V/  [Co"oD>F^^gD |"LmC>o=Om%j2 ?OP ? ( tO\'p'P pJ_Q%ACK[񯣢KVp8N&G8R)C8'Q<6I6 @ EXEϜ]0ׂ+(?]EAYg$cÂӷL  ^zXz ,AW\X~"ׂPxG] a`; Nl}`+(:KsSާdBs'@ψ 6zX@V.\IrJ$(Ez^\ % y+W\r^^/!=cAɕ%7\$(\((AE[ J>MPrScȸZ 悏[>>GBed\(ȸȸŒ[ &nMmd| S|v+A2>Mp)SP&3 #\b"*,b% XgasE w wE%Xu a",b"-,b9"Xeı X X9"*,bN#,b"Xe #,b""Xu1GÜ80Gâ*aus?,UK0GK0GN!ag Xg;[úX9I: X80Gò?́A-Ԧ6⟴uus7tRs7=F }-nc &K[6dmr؇iwOvBigg!Mg35uφ'SvqC8=ϴv/s/C{z=+N;x8}Q{8)u@s{=r@77B3̽g~N m* scx8&~N;ޅ?@<"w;LN;vss}"y]OS<.>O[w% g>OL */:-5ci?9 Cþ nImOR= /x)uxob'? ImOb zӽ3g՛Ϥ<ƛOy4Ϥx&LA{NxKrzONV?VyI$t^@zo46{}|=}?O>G(m+Ҫ@2w`g< @a`(<Մ VnҪ)XG8sA4% = ։fD3az2X-Z1X:5XOkEkFk"`MaK5 OlxbѻwC 﫶x_M k<(O&G"̅u0sa=a.#̅!bZ=V>B*=2Oh]h=>CC{ᬱ8oqVVr.펥EF7Ce=$RvSe lffYh>0C"f56#]fN4OJE"I$ByAJ'rȵ\>YV7î>RlTnzfY_)5ykEyȁ"IP#DyE>,r "."爜+rȅ"\.r5, 3fE"΀eNqkvX^+~"g"͠,Yscp*f7kFCXiɃNj 1idK*y.)g-h抜'i=EAqy / 5EaINyD~BY=6n=1UWv7W!/`:TRWkW`G4WIZDPBsxE3H` $JBsxț%#D3J"cE3NR>,"'*i."gf犜'i)ω\("EZkUd0+=,5Kq_GST^ ??pT;rP ,sU?>u 3)ykE zwY$rhЗ,GCAϱ/r"g#ryA\"װ J-|^vX*hw9}}b-WB@{ 9D{"i҇1\W?Pap* ]a\b\Zx<9)_/e-~Sǟ+&Q9y&6Kb-FsKb>5]Mw81x6P^G[ek-ny;Yny){;x/.W0>&Cb0gֹ[&kIP~BYT[oWfVh|^ x`/38fbo^yJW(3uH}mEZW \"{Z-TC .8C'3x\g x\ CZr$5c^ZB 1 1`T| }y9v[NP6AN^F Ǩ_ 1Ԛd֨[PWC#!;X C=PZ/GL}ݟ9X„\ݭժYgYe@ 3o7ČM8Ey4+lG8[.ghx?Kίj,L,S,}9rr,,+YV.9Yr~/wvkBoSU'6X/;g 1k7/L@A~|R>A K/Ś^h&W^}{ܘi.^W# jR|,[)V4Od#;X,jOgiU!yfr?@[<ҊϚ1g~k~iIq{f{f=ͽ iU]I!qЄr w'O?wwމ &JLc:>ˆrBJO]?xejkk:1MV!ͅ7oeZZE]GE9wf[^䂤wH_c{ Vk &evtvAjjDwOwOW k.Rݑ^=`r\wSY11eKu̝.iځNGݮx]P]\MQBWEʓ)ytC׮,X1z/Q\S])P){(3u{S\]aZ#\ӳJYI2U"ĩ.rR>$CwPA+'Ez& KJopu~QrY7)2f:8^RfZ*ϖGo0rUn2[.F֦@%&HTd(wPv8ڱtcV jtV.8.[{Ymg%>g94TE,]#Wa%kʛei[PHm-Lˤ9b@&of-$_BA&l% O^I7y_I5EY% O!Oˢb } tGQc[qǘ!0KrEV oc(Ko]vc̳,=Mh p [u}MԑfKpCb%T=UH ָ ziUV :IĎ/ANj[LByNV+븰l+g;, cҬXcLq_9eN-\f^[5JU9W ok7pf,Np&PIWCMQ/ˁ9>ێL] AM#+ucn@\2?8`R/K"V%,JY>BIb.cNGLڹczWxØ^FUFFY1@ e0;jiG Bx6Jm(ôa׆#\y^ ?:dC:\PPG{P5xz_VX4e%$jZ·Ywoo!IkW[~R7?<.+W+SM}?S!طu/hV]MGRk?=J%c_ޡ"CI*"cV_Ax~9ߠ/~bnЗÿOVf[|AGW"g?(*`4*327F1F~Ĉq#$g\J*zq dl\k@7f3:˘AH|c0'xxJ5/oa0>|s9*8&p0cf ~Y y!zbcͱ/1/yN@B,Z$7o5)G('O3^"^/[/gB [z {4ȴ[:bA߬wRU]H7gMAim!~4~''brRKmNuǷK ,ޣ\3Bϻ6+q@ Ӵefjo?M:;guå!tz aFc`V3|5;2 /^/_xY~e׸:E)D51ߘȶOO'7' [H*"\dTh*&p3=&p3<| f!ň)1KSj!3U5SCX7_`V <L9pYPh+ns9 1á(sBsQ̀D8dak#ff1Bqq3p(s\Mm6G#""z_ m1 ~9_b^D#~y“Ms W~|_0_"̗k"u *U>|CU:T)PCU:T)PCV:uR֡JY*eXzmᙟxηgxv{&9@"XWĹ=yWA:ٱBlP8'4o1`1v&fua`Ƀ0o"vez>JE!A?PoݱC8'Xic&iW6*~-V[G17SWmtlWLMMC: q "l7 t~~eq}-&P?Oӹs&sӏG|w6EKA<·.S㶊mZ i'1z?[ cǙWSK4||FooЅfLhYtxOC_Kc?ww8^^.a25D˙ '1^adJub^ʼx5s4M]+xI/g맷gs0pc>Ϛ^OUlGOv)m:2zW y N*hyoc@0g#X7 CC俬SS*mJF+IRLrw|˽dU^ZQyQnPrEۗw;]˻QgRoJIhiJDcu(49c \̵J\ĵ ,m)mmmPag^%"Ey1y1y˼X(3/JFr[Ip9Rb,dt#/̗6,f~*+>QyTg-v~€ğ'[ScS3@"o[q, ĘxG/BƮ+exz:9 bQ+b]#ʜ_Ϭ +\Pµ }NܷrF^us5kּ9Wlu{~$X[  Z) WOƦjQYX YŖm[yB[etp[ *sV+̯<]/{@i[}D&NԺ̺H⬫,Pźe%Wb|eW9oQ\-_[Ͳp$~jr{_s™lfZe:|n8}Y2Mw\,9estXZCȁuMNEl21{3;e❽(=1˥e9̜msiY&qp{r:ZbR?M{SMqrn?}L3"}.@X=0[Řeʬ2?e@fut+˖e[x% "ªSi"Muԭtl}³L*g^_O''saNlua;tgA֟a̿y6<Ϩ|HZ`ZNީUb arTgHL$m&êi%:c"g@~GKsS{ +, 7R;D.:n=#ԝ bK2 mT m2Umjv@vS'TτO}s:4@u: a0pAb5N^NfybX;U]IhuSY0D6& [F9JVUsV %#d;;n^;lnq!ioj{Ҵڿ1ŝܮzWpzpnO;>z:i؃iKIO8{/^sW gyW"GL9Eg L Fx5j_Z:K#ERȏ!oYıQ>SqV[æ;{Us>cXC ^^ f` eQglC_PFݻ껨==hiОw|;4Qȋ*Uϖ`)xRPm3I%-)I6 ggdD!C9Cc4um1xJRt҈`XEVZjBkR-`h- [W+C4~V?hnY `*Yéت-dgJKK9ŋwɑngݗ-XіT7&I]ދXK]E=>&fu3h }]}—+WA*T_ [+wO'm'$iQm(FQJ>h9ɬM{rAjc8})-WQ8Šfu=>Z@k ^>qPȭ-עn0>ifmVa&u2, 7nȚD6_)yeM^ћ?e6֤}rE{t"w]lu6j[,ϱ+tv$r񮀛z<דoMa=34w&;80IJ~&NmT3K\uyX}?>|<ߩGdj⥦~ޡ5NVA뵹E[=@ݵYCK{ZIYz\_!/t._kRt>W7H?[?տK чPE/4F5 }EyG?ߢBqON_.h}+ճ7u8(M`r&wt4u+Y׻uts&]m^o^O3̛͛:sfE4˼üf4\j.^\o&hJN"wAAt?H?k|`b8 Z?Ϣ73;(ȱUNy';隣]@rݼwkl>„]^2.2.& ֑KREؖo~&JYI3RNJxu<2ŪeF3h3կ$+Qz'ά-պg-NQS޷kUH\^mZ~U*a۰F[`}=C_sjSq 7(1ZN- QRTeϤo[ԉ5:'O3΍\KK[F śV9p|AFCYę|ꇰayH }B, uHAQ3Kn,J!㮆%+[ngtrl>KL?? WȵstRk}!J{|\>ԟ"gi994Ь0,sICk\ , BWWJؼRe\ZeY-˯:Y#YNK٥?A|vb1O'huu!/ҧւ|x\urOlZlv!*[D%=rX ⴚ+auۭbKeYW(}z}<Nӆ`V;{ 9!C~Ϯ5f {wi[vcg縼EٔyYSi[:[yli䱥ǖFzHeN_o./<Ƿ؊(e-2f!-<Ƿr(S]C;`1u[|zPCWS7pCW݇|+ztsGmṿsFde?f1[.5j9$Z:Yߍ-ʉ7.k O{Eai,:~qﶎ;9:G%戛3[11G\C/G ="wB-Y_jo]lkl{lglwloءؑرdfC[gO">,DJ,>*>Ɖ4>9>->3>7>?(~g|i|y|U|]'_shG JxE 5a%:%'z%&$'QǾĸĔčZʼneՉۘؒؖؑؕx)*jx#VĻH}?qd\_[7YmZ]m=j{[ :86د$2cmٔYSkgΩPMj^ġ v7Ԯ]cS _H¶xJS؟*~x$^OOOψOωϋ/ ^/7DWFoooot\C|w|o~<С̺1Ǔ""b6ď Ѳ+RNxe5!cƷ'ĞfKmAmXs!t}WaQ'LT}7~ɘˇ~ v킧Gw_l`2VpZ]s /6KXS ͉͋-#3%ׅ +3bkkצwvLEۣK xDWFoWFD7YKd*bķ`>\ΗV,{uU/EP|BS/vHxUp41O:|[tqe1EwDwE_}#V~|(=^+('ʤK3]]/Γہ͜O[<-nx۷ SY-8,":!>1ll@xWoȫ7"o~)Np(Xc;ypɨ͏To,ev.5fͺh311:0VFD H.Zv IѶ8>F#SDJU:#"eZs7KucW7֔vVY}c͉n5=XSӿfXM0{DX(*R\:bTi53k-|f Kk׬ u[xCDПyfOvƽ\Ro1* (|G5~SST V_'&ɶ"P)ZB; m;g 2Բr~ꆫ-m`hWЫ``N[G YáwC=8,qdXK]n W(`n GB; uasssl@O“݆=O oF (4!-4)4Cp[u]hFhyB 'CWnwB+CkB9HhwhoDP& :X]W]W=tn^y,tm}%cBk1I%LJ<4di=uGOb61zH}_ (x"D!O`P9TRm< n<@0o W%BCa< *U)lءCe7[=OIm>oOwT- V782HuNZ.(p$p nCU xZ*Sh_?2z6~76!5Kr\gz犆婫z4`0xY/-s|_u"PQݯƪUb 1vH3bz@x3s, Yd`i`a|ʮ{EQMӄmЄcۄBPUTWSU?kq 1aqhb6k\bbu mb\88W{o]w~u}s\n8F;Ѭţ77k-;|tV{D[w~߽\7, Eߥv-oC$@@/~r 1\d+ N= 9rd25ƫo0-^}dyAaOJd| ?٘>>F cH@^g|Hd\5$f#fdCἼfW|oZ a '@N=K3E4W\vci OUR חZv<}m=H=ku &|6 'igf>ggze뷃 ޲v'>3coמ\zVtoYOo <|x*zM 5|\ uD]R&. f իEbCXʺ.zuz q+pAwGcq uxIe5 -p^\iVj4 `fNӨh}bԬvk67k4;4{~AaQ )Ÿ́"fJ3M,h`@%b<)Ļm=FO)CZoMTIg'D&`9;CaC3<===%:Sf%˯Jt*Eku f^'@}0 ]nneQߪƀu㤟u˺k3lu-*菬e ^CK1hZ@ 1cY$*-]Ľ~J?T[N@O*-WT4;,}@_/VWQqm^7i6ԛ4;=M>p;IGG'i9//oU}ByIP26 A48>b0t6{ [[ =@ka0f8n717L/no FިWX$ז+5:QؘQc4hIS~4%v/m]SƳ 53^4^1Nt{钅Vq5%ŭe5:׷6ZMV`ku]kO־MdE}u7puxXIs 7[gZ71ҔW M0n*1LMS3Q&g .En0M;M{H5ƁgL灓k@i4o*sy\j0W8WJk3s:Gq!iDi41+4x<+ 1c{bXWb$Dh=bP;&IہCn*x#1xZ<'^/Wś)ޗrRJr X(ejYқ%Qr}İB%64^iUv,rt8*K3ytxM!ݒHsҼl-*ҒgQҢYJER \CĒaKѢ-.KZnFfKee]&u)Y"e 8m .X@WXbkҺZM@dY=֠5f4CZ-Ǻ gnYw#C#c֓XO[Y!Wzzz]z:k/Gp8hSrm+B[#Ve[QV[`kK6z^l>[ؖ0 ںlm^V۠lc|m{ll4{mPP1q8։팹[Sy$5vvv=m6o=v=^$g{)z9{ھ<^g75v#=e#Z{ҾTK?loo۷wwۏOOgj} mng #Ǒ(p;UGnѤ9L:b-EΖ :Gc8MaLj㤜o8N;9.8.9 Čqq1dLdw:W %igʹYlp6;Npag\unqnu9ܩ1y88AJys8"$cēxUs ӲN꾮]鞁|b]}s`rsuQ{ӳS,Ab)3UOӬ+="ʡYa0zO%ӳ޳rQH=-B^i:<`\φ11>žNDai׃˷I @vDL F||G| pNN;|||dOk]]Xcs}w}%a+B__7`8~_;>؟wm,LVG% ^VyʿǿPh `'P (,cT`-Kzw`c`3n{a CSgr.XSikev` ,m9mmmmemmjۚ6abζum=&X6жmm7ni;vXɶmW .n]jvvӠoiv?Ȃ`npE0Xbtˍ`Upu6lb{Mp)v7v{[[=*/Gcq'ׂ7wsRB+CEPE:&Tj{11垎ܧCKہPpc}hqG;m  㖆~Ca`p(j:})WfnR_)t1t.\Tp]i( MofCB aqk ȹt8\f+ëLp}) 6?X3.܃yNxS/"3|, #s oRjzZI|)|WI콆 WڕL։+ KU{>l޼zBhjwa$1m{d'ڻ~e e[ڷJw}=˸Qcǡ3M {ۯoi3նG>gȍ _EJ[MHEDLƈ?bX".;}xH $#k#ݑfKd(ن##+ ELD.FD"ӑ۰׬ܧFEhN4?Z-E+5~H+ZmV&q$ 'ƢuiEt8DGC0z$z,z2zZgEE/D/EFk73ѻ1Src+X9Xqu6kS11N|ppR)D+>!ܕEظ v&v>6歕q>+[Y|#Kz9ss+5xye\7-qW<ēWl|mb;1o0OEϾh+tv|6~/P$rDq,QXI' -2%l O"%:=m5M>@b{lCݦpb$q(q$q,z)q2q:q.q!q)q5q=q31:+: ;J:vTuz:j;:;aϮ#ձcCGcK֎{:tvu8q޻C혔v\qN\|Oy1G(YOV'huƤ&iLZd $ɵdr[rGrWr]ܟ<-KNM-OgɋYWS䬳EdrC[~SցGXz3Щ\Y}r* OXZDpgyB.߫t6:5bCw:Ý |6>֧;ܿ0c8{/`| {eO_ʞfZXQϰW^e%ywYi%/ļPޗ?żﱾyٷf%+Sa3{XI,ƾ?l d?eg5var;'9+*9gSUqvq_ܷs~Gѭxbb@nEŋfK⾨Ũ0eQpS|T@w܋WRL*~ʽJ1Gkůao㾮x]۟D7~Pf)˹)U>\Vae={e{T+5BSyRR=&Sn>z]o4>hJateH:t2iB(]閡:~{V{|HGXV>F=.~?1ee0? .]ş- h/?/2?55ί_CۙVcO YB.+ NP(dEB1{Z*ٻ5DhX(4M'X>yVܯr+7Gئ7S73̻ԥW}TߚJ>|_*)]|C*%CoF(=<w%tq!lŪafEayG!5(0-&~KCse>Ϡǃ=daI9=ž;ٟRE4{ w K kway ,ϰ}p}`x=.OT_KXVY{_sl9f5\xz1Ϙ3F{8 Sd_c: .EX+3\DSܧĽ0 y3/3/ns kvsY1sY^e1 w,!Kr?γ'GT.U}JJS=Z>QհϨU[ըjd/>QTfYUX>ݣc} @FA@e<-g@3yn717O/oo`yQ%+"T5b(jDh]b@Iq-n76q,Ľ~xX<*Og xe8%NY BʑWIRT&UJX&I'`IXbRNeW@JAl _Jٹw瓵?NYJ' ڋڟ&k/&k/!k7Y{)Y{Y3dd%k kY<,Ud'&_E6Adϑ?O6!yr N>L^G^Ͻ+/J?N>k&;Wkεd:3= }HvJvn hhX]|ys7M0ʩr2ʧ1*JRoJ oʙ]c4+A 2HTa?-sCej}_imFc@O nsb/'hqi6q-;. iO<>){HpT$:ޛ{I8}ȱ[oǙ.\XVB<`tDL; goG2C&dL?29sxX2[J&UT@VArׇr @v%3rdFr]˅m,q׼ם`үXޖL[nx`9jUǎߎdƗ3Rc_\̨/4[ѹoOgy+G߰?K/~Xpߓ5Uu?t=L38mcėEY\Ip=s4ЗOۺd`[/_lW <h^-{ ZvypmܶnWض7qEf:7yNfp |P~oih D/)@ށ3S0@ p 47st܇SpNsyIq(KKӅY&osgr:V簠<'e-K>$äs<c"W);8%?mC\ Ί23ù`&[.z}S^2PN([f{-Ͽ0]s,Vm z]29+\kesu6]!m]'+rr%==ey{E#\g]h+oc@\SiGjp}s-d BiخpD ۛRhYZ~6mn;HᎹgJ8? g'$Ea$=B~rycvPQzr=+<aMsp{eG:yuA tyAg-ȾjR㲼/=A~tb0Ikɢ:_^B:YWPvHP9=qaJ>*z 痤!(CoA -Q&-:;Gu!ǧ#%Ej^#dxyl(_ٰ+(7PI#OQ^(/ cx999S6)2dK =(GyjY@G:狉yTB^ ERr'")O>C!&ǧ;VFi8)עktTtv1QxIiʁ7."{c5g$$M4JB%dY2~& de$+[2kZ+ IGZd5!Y_YYZuc_yݯsts\:׹ut3m㟛x/oTBªW^LExu"1]bsf{F?~d~ )^+ga67c9mAr}yHC2^>؞K޵E{3 43LC<43Y L{aBB4OW-f4Yұh#h_B?%rcks2Fx]]}t3o"&|ہ{+A$>>O3z{~=C94|L. =MNz?u[>a8Xr6*ߠ|"?#O;1m_:_%/wFg)6dԥC/10RXKc c,ņl(e{륗ՊZQ)]S@1=h[=h[=2]G~tRwkԙWj[{b`Qة 1QAt[̠sb?c1kA^ ލnÉV{,}b(؇>PI ?lV1"GΗ3Ue %'2SLѷDZ3jhab 4j[@}=A|y0k\~9{CwkCcP=n'&Xv#o",Ci'bFbrbˬ˼ pb|b 4h;x2lǞxx0e;al?9DvCNXhUM_BlBNw;; G@,03p̊یKf\J^FWl5*?2*CwfҮj')bY-=**pj]-'G_ʷ$go?et˙"v`N*_T(2Hշc?fő1)Q)dۛ[ur F~{ĪsoWo)_:K$M*"Z8t5BSCT_1ʑFOsT{7cѿ Wqrn2U=8ԃB?[i87rȷ7F7cw f3724k#8l_n9xz|/Ɵ_ӕl8ǎkϚtV ϫfYT:t;?rN/|"d&6d㇦܈Bf~ ɛN*+vnbJ[jx79qjQw9hT!_ jc]Q}`:s#\' &oSG}B-T)iL3Cs{7SWHw=5"lۢY%lƞA-[PUrLkXepTN6 N6sjAЂ6{ع64oduZjg+IdީB;)89 v!V!5}썪5嬢 YUZg?,N[_+gI 2Z/Botjp)ĸ~VSUf#25dBr6,Q/J+oÌOƒ=SmÊĺ./}-T,{8iDe}MG׊lIQzWpb {SU/5fk 隼V(GVzySfýпfT8k_{AimTwXzF{bXjm &ىRnU1 bj̛/E#bcvXCީuDC.%%7i-7|;4k[9Q3 FW-vrc nD]TͮՔ:^6w~>pfc͕=i~HCrֶ,}4×s.j;{vJ3K759TD ?F7C552%Du2X;^dmC#.>8=N7O(.VtCr_Htz{)LuźsЭ8zaΥ|$8wpRe*uȍ!V$NsԐ"Mkn 箲%y:y4'(mc}W鏅[%{[vҒZEMÇ{sWp>w{V0``xQ\YZ.Td}Vzܤ݂= ϗmͲrl$?moZު2?MFVBjU]7e8: ,.Zglv~ʼnVY]̩OǓYNbCDK጑g-2T˱!p>^ 7ݛ4#YĊ[?42X|pz0/M$B$Gdڣl>)ֶnVfY0;Ky{A4*GNC8uفLsYij-27k=P^&]je~_;_%ZaE9Ӝii=.WܳaT Ś7Bi{ Wwq^;_9襕[Vh[^c6yIiVF7mj Vg\2 9*J|6必Wd_݊uǺH VOagiehs~>#жNs8[Uj wb{fu{]7w̯<@~$v9U =Ĩe.:t NJrl-p9< N1x| B`\5ΛˎudOmo7Z7*Ͱ⮤f7N؅do=lTy Oj}uS7_(Y]W<3ŝH$tqxkT9}evx,CIkb/:((b뽡NXZWt>3oT v=<BHZuL+8[{(p_Q-ycۄbNwGz^_@SfX'SX7~UcmQکX^~>zй]NHpg`\9BpK*s64P/abX:b`q+x{_9N;/ju~:\=vP2f#9C7r_Fӎ/B__#{Qpjagu])Vﳝ EkvW𝊭(v]4t@[ܹ\ Jw>l =.h(ߵËC$?{lO3bUpn'u?wUۜqaMp.zŢS)p {43@ﴇhA&{qZaje۲/DztUFB h~TgIƎ]pRMAnkh9pN+ݯ֝gr*JU MS=S[#Z9ȏo_04o>EwKz goݴ[G#,l% mYptbh|/_u 6x C_a>܇f4FCF:U[چ5 Cchˠ9 x( Gf8t7nȌ@f`S(mE"b#Vi+t8K?DC1t9sA/C{y_9ϡkvIIt 0~ ~ ͐!~ m?~g~g~5FZ(a.J\J0A՟ ~m/v̨{3;g@n<g=zU~}}E__!3ЌaN1t1m:KɮiӠ䒝qz O[kmb9`2).51vގrǦ1h; K=xc~5$ ֦tA#W\@޸{e/z^Eϫo+:5~jUUm+1J12.zڣ=6 oAgCg#p=:ǣm<,򼷕޷.2 2Kv;Rw?ʥ&gHdc47K܆oC"!ώXήŮ#oj FßE=>G/9ߠ713?>MN`W~_/30/=z&2>.{(o쁎Ac=MimHpw h2Fw"D<On$F^|3 {6іbFb֣/Euɱ7̏_v 7A} wa3m7g'",  ;KĪ9zFg44a:̚ìy3xxN̾KFuMF}m>@Yڽ˱shVk՚L2QE2y*G{^_EԀfأ]rKNs61U5KӗO_@ ~г'; w@"./4F.u\j/GMxf^C/GOeTFdOFܵzB@@[ߺԊ.bl$:Gb'rXechvjT#@hSr'}=N_$O§rp zddb%# .˾ʥ_*\Soqʾ_*խ[ooʷ[y}֮m׶yvU|#>ķ;.|v}ޕoauՃoy|INCHAC5O=H'ѓ%NJKJJ#B" _ȯ*QĖGu"0$4&幔IL\&Z"YDv9+\~6gWy+ӺFftU$3ڀ7Yl,^,^Ϸo߲Xh^)|ć{LJy6||l|gj|fγ 8^=(sxixA ^~֌ԗzf<-A )wA`gP04zF|>׸`<]s3=̕G[ȳ$X!x5-̳#ʹQ٠$zv{/0簌X#N=ez*Ua3O6OrAXba9OaW"~ϰJqP3|8\3,|: 'LgDp"y9+p͙g~쉼0n!r]c^Xx>_4ML2IVtvsSLCAƆ ʼnĪĺV:$v$X}CIGj4ћ&L͇:͂ɖXl#qV[LHv k' do]Dd pJJrhrHgt5O#Q'v$bKqd!9]s Kܩܓܟ<<>>NfLLusVf&7S'># Rv֙`h^ڐtf33ѢVdde32[hGJ̸vjBFuȄD`arDfzfVfRKp2370$94":>9SٙY>-?$ggLtɻp]UZu o7RY-ybT<׺U^[[{]yto[gmǾmә|R>hmQ*ߎ}@-&Gk:x&ƛ'mPhrW=޵L~H{?|:,0LiQe-gh,3z&..rƮ9stfO扱6l{[E=ymQěQW*m{lepZ_ON ³{`L\9_%ՏRceL]?XzKM?`rQh]! *FE(~gm2G?Gs~\IfR݁:ȎrB3@b#ȋw<^L2].8͓sr9|>l-r@rt 5\Ȁ6:ZM"@b4؊@b01;nQ=!,8 2gkW*A\ сX >/#> F3ʗږڬnZ|6+ҁ3|<|N>SDyXui=1N\}fCGNZV{O@uug|3߾@ f  $ ϻz[;; 7Z`?]`HB%+V ,P"S`OseE?Kvʽ?iYdv ZPCٟ2_th Y?5N:47O!_ٟf4[ڡk4ٟR=n7ݢvڭlnKmv@/ow)TP ^A&(hUжSA SЫoAC3`k4O*Iu5&cR"" U?B!ЎC!ơablqb8mc :ƶ1u 2>>!5.!P{sѶ{wt=};=?:b['A J;g].W>uۺk Ymuζlo;b[bڮk:n6{l-vF>ewv}վn"{c1\0{/9HJ́]J:O$4<*X؀k³AɰkDhQo5 h"M{RO{t-[x\=§> 2s"K{E{EdwlHx֛] ]5DkEwEaz7zP|ĻwޗOx_v _m{of8j߫s09;`p-196,MV,  y**v⥯lJ:hA紪TWXKo&КRck췼XXaf*+3a|x*JH~!boxM%R1~N׻m~Yn(~O<+.%E}4xʜe17Ă-8i.5/jjZ)O{Qh/(ܾMM"/wA/ w_b_hS ӮG )*mk ߸c #Ƙi2s|gef4J\f4WkFij0w{aȃqyyۼkͤ4Z>+ʳfZ-UbeYjƪ>j6klZ-VauZptu( ϺhuDZXi XaN}+=y;δs,{]d;f-RY^e{n-w{!nMߛt}>mNm˓h_o{OZ"-MdMM' ezļDq,NJ,KLI=&֣䍓b'Pۘn_%'|/^Jʷ kaX ՋT:E:2|_}A<5Kb:K"6ooxoo)V|}Gs6E NNUsn2'~Cf+t)gǓy==y߅Y5x~{ ;4i(˲c3&6{W1grX/;,1 #zX̹$\A=vڔǥE#QXǣG kѣC3KiFq n}k!k71n#L7rM iΆk4%f'i s1P-#F5ͺCt`GbyH*>jϰyGqh}3i/DJKSsg}MfFƮ۷>s0I'|t+#{Lwϻ99* SDI" S ˊ%2:QK̞;fʼHO.QNYM4XKX-5l^/{㛇1];fO>xƷ"˷۷%jW;}i}7owr;vxxw*Sc*Kx$nGǫ5x]>o773-3o NF[mD#?_ƯƯo}B@dg^|8Tm0R"edFNl1Øẻ^3BFit1#Qo,1Y:NEcUbGEF1Xgl06U覬.=YwcWHweQCF.m'd%-a6ʶDf4,,s0>G7!_Wڈ/ޮwew H y2,}NN=t׵Ĺ-bhke`b}U6$ܰlov@7cso8o9z[o1RF T:GIT[{{ ;z"z:z6MD/GEoDw#[1iwoNm⨍KJn5]3K ەvLG;jΑ|G~ rIA"Z:^ @ȈVF.^ Y]]8mj$8uy0Z2Od\נ~Co.DOw_;TvؕNȵȍHNd02k02բiCQo4=]\v}WT^yupu O?b&˿A}ZZFc/qi7Q̆ D;vR"uN h(쩾ox`>oVu!hߔ)Ȳڀ&_~mGZcpV˂+kF[wQ@8p3;<\.7K]`}GzSF`g%=[bZ"@-PGf}N>-w꧐ץ/" tWo?ߣ=J@*bCgCPY̟*χJCz(JR`9U @&` bu{Z:FNgDD'tyJZ⚣FF1FX^Y@nh0g˘6•a#t'\,VFx56F`^ `wx/M(pq8tgG%.9Z7]`P> O"2"/|b&0_QR"^\QtME-tP4hWqhڀ8Ey}U:ӷ*U WV G ^$r̀0g2(t" K"K1GVE"`o-!.`8iǐqĆ NgnwKp78{;#1iGH?xz?%mDs`e0`8a.{S|")Bz`# pV`^a)z$z4z^{,_]z}rJ3Oާa\i{cygr8A{'31}/Gd{+7]{Ⱦo'&$|@v('Dl-O~ixBLbFfH,b>K*srfO<' |r!*^z!~+˅&%+cw7'kk~S}??Ş7%Ǟުb~0+G Ztn5q*տ-}|0|||,io H  @A yF2P, ^*Xhvv{ap88 ܃ %L/ A - zt@0⊶@I`I0@[H/k.* `#ۂ;`MJ`m`PlA\KۂNT` 8_8 \-ep= `w+ǂ8N dو ʅLe OgK2 L`0˟F+"إ_"-x'/_ =8NEɲW6 "y\i,R`I_Xlo-7?Gx ~` }lĕ[g0}elǕw=zkc@+p8M;|,ye@X?cZ _{YyW=hY^7A5[vO18 TU<+ '!}GSueM} eɺI;BY\y@1` epȀ]b2n}$FaG¡,B镌] Ǐ d=k^Fn(끯5/ ^cہ{zkIP*o v4Aʖqȴ.t?9 `~9z;Э.tnBū/BlPDf\?;L/ѥ_7ԗ1}`%߄q{; ci ;y{BUcglO-"C(cƵ- . l4U.-? l˿>W;r&sp {˻a[6=| SH{.~w}`@>  rƼz{'-` +F0?aE+23+fs*k+TWMLb_ߝ%BϿ{Ts^yAk.B2JJ6))BrdCh?YېJ+NWJrYJ!%XrEin`˿҆TGc_8~-+t3=lf=׳>r3涔0pFY,j(K$1zE1r~%Mzsv&=K(gpYM<&g-'Lf}2'-[i5j^JamiXɠgXO*A4^MRc i'?)gWR2=CGuLګekGad7KC{7W s_LO#)%v4=/f+~:ܔ#yܕWXCd ~g4_c d+7ca(9g.^T?:lMR6a:ccC*R ic cj)IF\ģsЙ]2>V)]Ig{~VV8N!qqp08|Pݞ)gg?KgZm/f.|uyG?]A‘m <g)B?[}ǞW,cRȱ֩ka5~=5)#ϲ,id6,XC,Y鲜u(Ww[ߣvf1wI1䫻':N| 24ܭzOk]gՕ/ѿm~nLcn>cKoP6Sd)e-+)QjXQ&dWdeYkn6-I<1gu?w_H!dPcNq)~;r9lvdSuNq)v:HSlg9S gL)&3aob,S,eL1)N2LGDq)171.XpcKaSa9LF0!`R,_PqzKx "kRL]Ks)^.G1Wo)-ŹmgKi)&-šس,ŘE!ŃbR|WJq\)v+kRUgZ5P8;E)k@)*&H8c#xF%bQRI9Iq&9lISCq#9HP1!4~xuXcN#1R FH)"T8v")F"EaRCmbRBR;bRA1Hq) @H%Wx%[sI^@{'YnNV.]cC/(G[WzJ̬M${z2+Ev2_g9 i/]j&2 yi\`RO9Y|h1WW<=OѮ=ŚTP01k h.诧]\b> J9$Hi/oca7K;H){de5cXI/{fEJv:^l]I?JyԝHҞcO@IWX_L_zE·iY!)ɳtaW|NnKeRN% m1ʅ=:9Cdo:~QwXagrZS1.Yf1=j&((sW0~x4Je$4YDvqӞr5YF9ڟb9/e4ڜii]Aϟg h/0;ٔy:Ϋ9ʯf.F ?f弝mYfm5}8ypU >Jx[ENodc>:(JOi_c/L:O%q·:z^8$_̧Q,ayFq+Yh_}?Xfi$UJ"PG.Υͧ J6,X|.v{Q %n\)3:\{ T~Nɷ^/(HP[#7?P7|sR~򗔟|=F~~>e _mU7|I7\zآ 3L7w&~Be\=<,=Ǵy,"D3WXDɷ 1F3η˷"M5zt)/p]oS]|_Uoc\(WsL{giDw*%JLYI7O2%&_p[a}J~ߣsuz^;j^|odi+whr3%.'lj@G,H5%g Usx]^MGJ3u-u~u}Ô(]l63~^gh#Zz|k_so477.NsY;U?09Ia=G}Qcp-mz7w ;= ڽZj#wЯJsF?W9g[pи^\vl;KTo95δn7hs<S7W%簛;L84~76ğ;s n5_Z;s7Z"=jՙ-xxxêGtf|ɕソظ KKUϣf\j}5ᾇx+e~Sk{\_uVH835n5:jͺ W{vt7(S4Ƶu?ql71zN5^O=U?ZZh՚F7wI W\qIΓ$Q&ygV{M}+a_%W㼦$9q?=sI:8Κ$ks?I`:'ՕB]x/7PI^\I~5NZ9uX$N;?ILxsF%"9JId!ed\fBR ?m:zVS(k {7w_Uu$b;s&s2 d9F"EbH#""" *EJcH) b#R#FKHiJcRʥ4kgDV}Oyg{}ؒ gdKxlߍ znUk#$:~@8VhJ_8mDQMo |a#bxK2$! |i.)Og@eL%ڣK`CYth}W POlaAG '&~ /.c=i}`sjC;~m'h`K(Bpτ vzX3ѦnAi:z-m:=ZFHbh_Au""ȹ.I] FIWGRמʿz-\?5gg'ʙ; oaR |ވ|#ҥHw$6͈; MӁ?@/4H05)Crfg}W`s|<ж}UF~r]kO)#UB_*Ta?PÏ @=Wsa;ڡ beCҢD'gyMR@gry) +s ɛ1Aƺ{"U)'3Bt륊AZՌo@,<)srK<\3!w˘x?2x!62*".^Kv+=2˓ b^tzͶȽX 2*9/S絮S;}F+^X}6t3uymI6 g/h>>ch,i{w(񤁧3S SOot *۳L~<I-:Hҍ`SOZ_/no$!]Px>F}C_nhx{\46<8y fߵ?Kv?fp^Kdz'אtnB@<;AyR\vN4<˧w9-NV;gDnso uhm4`7)b+mÌm]Цm7A}㕶ϧIc G$ ޓ£JZw1 by~Z~3 Y"_ e/=r}}b&TC=K"~~L7o{ ^~~ ^ yg?~k'Mg4L~Qm ÝM͌}uE=v5PĥtI|RO"H%,iRZ'mvI{Q*]e9CΔr<@&ɓRy<_^*Wjy[nfܦ8G(}AH(3hMPYT(kMJS٣4*GJrAjPjTUGcՉTu:O]PuuZSM)zIH3fiZVM֦kei\[mjZ_;Nk8=QTk5ۚKlUbY3ͲXE Y ~5(kĚmᬧVZkm}Xvs*L&zk٪":kUmmvXu$ZVujr1v(vj"'vAb;cc{FbSkMXvkUO9m!Rlհ6I[[mTbɜFw[{[8nbK;,(nb\Q=-R+gQ=.VRSaZQ8EclGɭiu)爵ZKX[gm@-RC:廁Xú`Qi LNQ)Z |hs q S(GAh,b #fZf8fht2]TlX%۹]L Fcb'9]n!vӵY8KyەyLl3*Y"XbR1s}D\(E5}Xu:e@)[ve5.s t9LŊd%Kj5 ڀ5ٚ1SD*奔G%h MɘV4i%f Q+uI=f ;M5}.Z8k]~%[鱃#zX}1ٺeb{Y5 +\)նئ5FXX+`-#rbU–/"6=bm vXkc%ĚbxbGbuXC=;%LH,듌9 ḧyEXVeNݝ?&ox8d!\]mf4,t1WZڱǾHY!p]qn{Si$ܤl%%g?LzvIߔv__*_{H]Sp'ߔ'99V_R?Z SZ4M|_;;j,#eJ5I!i&یzX |VDz~]Z9??$nBNũ,˙)|Έ3[8(v "yGEIRuΗkwfZs#;u'8_C6Tqf&..1˜h-n6f-##bxxF6mƫƫxxS| Qdm2o+0fqb|"31uy]^ bkk5uzPzzLLw-v-3\ϻ*LWZr~I<~ͧ ==O|Q,v?lb!qLYqAI2 I䑂> i xi4ENk9|Z/>-*UZiEڱ^'5Jhx\:%H礋Rǁy4Mț}YRGsfި<MHJԼ dJ^i̼" P{GƐ,zG#}G3]^F.<DtyDi6Qm@ h6Gȣ3ρ8N6A|t 3<.4ao}t3>Z{ %c5pp]h%p%RYP9ǢFԳ=#9+{Ews*AD4%%+җE>4GwQ'=9评?%ԜJ/Ӆ.b ;kv~ȯ$_OI.'_[&֭*)䧃)wA]ΥɝI~ 2|C>R;r )ɑjv]ȏ$H܌ܡ /ID}is%~+)W[-8q9 >_<|);z.Ρ蜕+^YO9+5@ey)qbXI=A4KF]eׇٍهf'v*%Sqtϡ1>g),s)F-ٵRl~:14Ut]MNv9g<r< )BBO!-7i˩evDZEvm}FH⺊썡g\3RTVPo43E&~c,͔ۭTϢK_ʮz 5|eac6,(.b2Z+&bvJF_1iB3|~ Jf}I:3C}&8&f>ZIz/؅ y m 6\ hS[rl vֱֻWP]V3uK+PwI#:gV]Zͬ6/=넖xGu`8f4:&x.h=zFI[BP4l=-]# Јiz;X jSZk}LxjI[j B8<ʫ@=z~Y9Y9i#yK%O< }˄[ ҫ|WJxZҕdu"\NOu8'eSpi"+4$]{Hyݠz? ;/T%%fFۑ<<e>%4iΗ4sY?`>@3&ͻqķ:zYYلL//Pؗ͗I%');ctGȏI^/N^'vtW0:}3>U1WQξsec.7Ukfp^s?A#1y\dno} 3CfwpLmm̀2CfHx>f5ϼ(`se59ܼȊHۼ-"Dnvq]`\*k xBI$_^)?6yI6rKgu%wD9enNq9,}92aj^W`^sPA: '  7 sP   ?^˜zc`9(qzulgM -g.R\ TyJc a4&v񚣞KY:}GݶqaMFwog$_i|6'=H څf uBKğK\-E Po\GQx7Ysq?Qis:]@&wV1`"SEUUfkFҰخgaJ|RĉZ+-gH1>}Sh#@xF<7NrGHڀY33r5xج>wW[췚IR*.vf s]hN!"qlor+VGp_SLl3x/9OdcȼG}#fVw"ybVo[84J3FP-JB︉{dZ5GTE  ]HVPxp~xEqlb ja?SIg;{w6{sG_c)W#>*ymޞGloshطr ʟ0_3Y:l<ŽW-Qltg IWv_9׼!Emq7`ב[]ph21ozU˜S+BN]~A<\n9Ҥmp*n]S6 ?4O`S2ugr[VS=QEZU:T{&rMq.͸D5XtE)9Tm|*!鋞C>e289Id u/a<}ߓ! ';^m]r~Z66} o_OrcҒyԆVA[I$Ͱ)BlE,+i\dIP>3|"@F>ENtI^'*aHgHE^$%^|:Z׿}3~hk(a r/C!4LDA%邟nH~m՝y8Tg#pfP)eDIIu2JIDN*(zm-%ɖ%QZd}]s繟ϹgjcXv=zBא,(ya3b߂[8 )F?,@in> x,mHB 9]ݐ=JAx$mQ<`l”8wk0v=Y +}Cka:m-xC崃ꩇ,!ijP͐Cv}Ї ó - E0MV2s"2Y"t<7Za3F8* XjK,Ra` Xv|an0dT~`͖kQW;gسLHB,L$@`oR C - +&r B%bA…;`ȉqs r24zKt$vt[/?7 ce%t2:KT o/N,,lEU+Ӎ.j$cD6&4d2Agyq% xG#= `W,a8da`"9h%Uu;8+m8"TvA +:01t{v.'?E.Jh־1!%F$9 |䦹kNMqѺ(7%ӊ)@NO>:Zyj>Khǃ|O/Պ~^7˿h\{w>Xe88%"1Qѝ54z3MoP}t=Ƃqwi\G9,878"h@RI>%^TM-~]-qf;!I9r&,噍qlljIv)?` 6f&FQ Fj yRwixtk cƏid"4WY\D9Mf0 ]nS3 |˂D$y;D+]5=j1j֑0-sdmaYv˕Q(җnWzFAm^}& -lIqχ79EuKb㭛"͊Һ)sm^1+bɭGT-+ 7]<CvǏurM@;XsKUaў2x1-jlB d]U݂[vآ.i [T==08:&^%|t`^gT#4gl"sV\٧뤰!kJkdl`ZeZ(5Md Lv;񻅊\Ba?}1Y Nq6dA\HlU%tuMUwn @vu'hiWt\W9ZnHn`R6 78܍)inLQFAg]b'| 0\un3`߁џyI!uW!gj;lق}oYiG^Csm+]XeREdeŏzMFi%."Y?R0EYF L9^iyd혙rħq٢uq2i2n rxy$@xuKdz| IJ ":#4OMٻ->Jt擛2FfqWC(}MT)#n4r"*4R:Nݎ}qQE ^"0Κ x(\#9'xӓjp1x '#y!E0 (/w/ğ '`B4M"D$4#}SIlBU6G1V2e`:񧴖>_pzV3" (rO.m{LLSwb󪙛SM8ϯ9➍:»>TOmt4zqHg|}{фyz`'H=x]x.5a- l{ɘhuC;<+ (GegpD:RXJ*hRK6FzC\Y鏶Wh>iV',1O4=Y[NM,BHk ~K6$Q(!o{8 U ƿ?lv-󏈔 G{w) VueRg a2B.};Ť9^ 5q@.`23ga憨e?kQv Lc`7{.ö;`| M > 7NAo7!t|m!sZ[%(Gv]Z@eE53Ժ zz5fx۪ xyv*nL4H{ab?JZkm];\J.Kt_dal)JxIzJ_*;S W+^em̶?=ծ;aQv.7;kBZMۉ]gt6|k70rFmSiI""x؎n#[a)zM>6 ȱ?)ntzazKmxM' }]Ys;-#ոUxVGhz!f_40{q%.]1`f'FO"(g=5;h"P䚼`S_ۗAѫTb^ǴwQ˼ >03E}q7x5R^u6yX|{+G2B{+L@@يi=8O-2t&B&VwF.x>b}wZYv/?:hs|6Q,A 8PxW=?ŇJ~"ݬ)G }CђC[rԦw^~Xbʞ=ѡ˜ZpPX]0rͲڬw\6IòIa?pSlʌ2La&I9ͳ4fe~%+[S$z%Q՜ĠbMQE-/ z? :aC#9rJE~E繁гS}U)N`Yi;|㒏ɬē[D=U:OhB$s|]GʱCwUwԾ:cJ*CE1|mυ?᾵14bm7|. Pwsgf{w+Od*kqw7IIS|`X:8=vZnCr'PNH!g@cC 0lX>l ߐBHGNRfSy'Qg5U+28ǃekSYm_֋ v.^4y'D?JǺ\{9#B=m'+d4ڢ7[&^*<BT培̉MOHY6bx4x5=JT^໳ݱBA Ƨ´yS]]^,,}݃2m_-5sU*5lt?UxP+cY,B#" !!ަoGxhK_1V _;):?PzKߺ60^/*m^ab3.+f"b/~2wijRZ/'o'_;xv*%D?4<&|ï#۫:&*73 {l1䰡> u),TQb'uㄷ3m}mA#S({xGP OXK=% JCR}&5-cHpұg4:d endstream endobj 64 0 obj [ 0[ 507] 3[ 226 579] 6[ 579] 17[ 544 533] 24[ 615] 28[ 488] 38[ 459 631] 47[ 252] 58[ 319] 62[ 420] 68[ 855 646] 75[ 662] 87[ 517] 90[ 543] 94[ 459] 100[ 487] 104[ 642] 116[ 890] 258[ 479 479] 262[ 479] 271[ 525 423] 277[ 423] 282[ 525] 286[ 498] 288[ 498 498] 296[ 305] 336[ 471] 346[ 525] 349[ 230] 351[ 230] 361[ 239] 367[ 230] 373[ 799 525] 381[ 527] 385[ 527] 393[ 525] 395[ 525 349] 400[ 391] 410[ 335] 437[ 525] 439[ 525] 448[ 452] 454[ 433] 460[ 395] 465[ 422] 853[ 250 268 268 252] 876[ 386] 882[ 306] 884[ 498] 894[ 303 303] 913[ 498] 931[ 339] 1004[ 507 507 507 507 507 507 507 507 507 507] ] endobj 65 0 obj [ 226 0 0 0 0 0 0 0 303 303 0 0 250 306 252 386 507 507 507 507 507 507 507 507 507 507 268 268 0 0 0 0 0 579 544 533 615 488 459 631 0 252 319 0 420 855 646 662 517 0 543 459 487 642 0 890 0 0 0 0 0 0 0 0 0 479 525 423 525 498 305 471 525 230 239 0 230 799 525 527 525 525 349 391 335 525 452 0 433 0 395 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 498 0 0 0 0 0 0 0 0 339 0 0 0 0 0 0 0 0 0 422 0 0 0 0 0 0 579 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 479 0 0 479 0 0 0 423 0 498 498 0 0 230 0 0 0 0 0 0 0 527 0 0 0 0 525] endobj 66 0 obj <> stream x]Mj0 >dM),C,rnB6}Y=uw'Ǹ-€'UWM{Wn;$;j".78<0o=Mpk8#%TۂQjf]cDi; "©o.XdCjyj0ګaq}sq߻+);(ArOx[S 1So& endstream endobj 67 0 obj <> stream x \u?`afDKFM RӤ6;(ʲR;+Q Z-J;4|;hq®jKnwz+0o@ rwN\j !~5 A p. ?b>|<4W ADLdag?$\'֘L`H|Yyx_G aSarz"JX+OMmggaX+s.qPsE/[z4B:W|ȊN#|^36s1qF{@k/W/vn݈{jmݩ8MgStU;yv-Յ=K?pHσ'rl3ǹCE9U,qe.6+Ơ~yoHm~m[A.Ag &Oб\Kb~kpe=g_=w}E5.O!ώYN@ps\"i!l/썸OMg5۽O|ai Aq-ݧ?{sw[D?{>I%~K`Y=/8|GUz@FEVp @M $0{`>=(Um o ֿ_ݿ3OhAa6̂{{)= lX6Qh )Z|B|oygj'>Fd1tP+^˄QoJzwb.!Lv;!eRs Wl\::'>O|'>~{R3O|'>O|'>O|'>O|'EhLZT7Z9$W1PPy6!yFm'>O|'>YCN` C ca ! Cdp(7PS 0Bh%[ Opހ/Y!`5d (XS)Tbj101]G[߄ a,T"(տosZXpC?VJoo.~pn(3׳FpOWWNO?|5~r09Ϙ[OO%Bg2߮߼eg~7az_oC_\u]vW{&wݖZypOiK/^oSUZIjcJOCK߉&h0\RB~u%7xZڙa 8 N 3Q4,qJE\a.orJKxL%A^ڹ=;sLx~"qR,ι]>盜8WgvΫdֺRcsqRR)ې}MNA/B /Q钢|FFL}ٰoTFr$8stINGˇ$W%:͕5rB0A+, ,\`6iMe ]9v{GKi}S\1\:ŹJ7(= ϞN3ήܣ0]St L(/L4] ʍ=+:Jf.f.< KiWR ɮv?\,sQos 􌖢ȫ4uy<θ8\jNwR'|֣yN^/m_5xkeRP# NT#:W]*oԹNZZ pکN7d1gI{2j8ɢ(6VGNSc͘XoBoˠ:J=Y(̓T&(]VyXe[RWWGbW{3`Z {dJo&UU^MuL1/ÓwZ]Ċ< -漾Py8@V?>r5]Lo^7@&†׌4Vdל_O4;@jA,%?R ؄*L\VC21]y+y*s&<{Pwh4'1(GC,@##d6ҌG!MTo UMi1jQ)CA%$CV+QoF=z 5` ˚0 sF0a (FClۘmLC|O8N8FiQ[7 ݄#d% 'b>rB݆(ćn }{w);{ᯄ7 oBxU+ /^$|<9  0#F }BpQQ>=wD)]wDۄޤޠBx*{ʽJx2 %‹TT/P'^T~~Ip:YaQÄ턇e"'> q;|2nw6wqeJYP͔NJrns#6*p+a; q puFy\G;r^Os"u!q6q;l$>ԽOމSqjk'Op%p bBPD~K ci0B(Q=D_8*@}PC>zVM"L&L"L$L T*q2B)OΛ#@! ф(IoBzO8?=qc~ gGꧨ~AԗP_D3P_@}9?@j8㏡F݅u}|B200HCh fff# L'i`#X4B*a!LH"X47 3AND@`# AE&P:k2:z11J;fqvU˶rV\UJT#.]}ջ+W8.ݾ![BP./ıl%%L}qyӶcmbX[mֶܶ]m.~{H[Ȳڄ0Lqs\*|c%ْ%cK%LXª/0% e<%e%KKċʛ-ۛW7oi~Yy]C9@SvabLJ0|ioaw0\asR>T!,{>ep p<⳷A;0gy}'xvwf>}Sz}w&x=O}QJsKGio {|7)^u Xr2<4WL|?w?k8.]7x|0=ZbtP#'p!)=ЋsL`" J*cr3͟0%S3 dA7$E՟|Z i%02:?8P9gctbRJA`3ùO}o%#o k(`6z*(˵lY=8VzɽYSG,M}XQ1zbc;Q9"]Y2uLrhR)-)ze$G̚|>0iLJDKo+)}\Ft /'{fג1<5@X🼄ȺLJgHC?LCI=]/C~cyTbX m\\:p?<(p%%S eDጶ5onrn~M\G^e kżiiN,_a(Q樐Ȅ)wv/G,KqXڜj.li%uzK>Y ]$WlrwY,Lfӡ ƲYjEdV;&uiPcqlڃZ<";Tpx⑗dhW,$8`RzYPX􋟺siZ(EN̡&(،](&#/ 0{u4O}O}Gulm@J.c,F z[eی):u=J]ј5*/[ҒTQW/e Pov@R^a#{ÞH<1ҷGZ,wD0>'Ho} ] ԯqκmQo65xH_l6*T>~ᛎ?4ڎ%z0,J0,a%k~pIAXKKύDTa==0e݃ݾsVd%&+!iwە)l$Z 1EcfYVPE\_|BhTl,`#QY=G=! .CyJ@xN=w{w N͂Yz⦆>823AD?2@gLSCŒaMε9ZM`d|tMjd˕tN({ZHo$U4%\]8ͩ!ϖ> Zhώt1[r9wBc^ԭ}n?**fZqL7Ji):]t0wWBZ㐐[Vtst,Lma7P_5t=dU&W:2>'ge uggk%8-;;8Ƞuifa˙y%=l.yRqʐzfgĆцv*7akQIt2MK'E Xކjl1'?_dsȆ$b)A%Ѱfᱤ 5((UњƼ))!AaBJ5^!JV=~v[/ z#?SO%ml^eɱKNwoQ̶ X.>1ŜTLA 5Z9"y%'%!dKEu5!h|}Ww Gz)>-Kod $ZӜiȑ _,>_M7d 2e/o򽫤jw]dI^e'e[,$ٰ$!aM)eg L CKKJJ!eW NJ7B_y+ɖHgw,jf~ aq]UlKGګTt]:zͨh,Je5 iXwխZ.P莝=h )+?`I.YG(n{֎=7M9 l BcxkiAEB RpʁY&\i AYԅI,yLՔw˖҃Ykom}X8ت30Lsc.\ ;Gۑ18d23Kd8Ѳfߪ{FbѮ0VE• ΂^w pu-#2KL2M  _ ; b/Z1- ]Nj}NBla]$]ih~ Oق&gI˚6{@hdGij 5O"N~ CEVvcji\5v:;tWtI Hbe-ۖXV΢9p-w_sDxOb9A |hEbokbM2*TPS4.:0)HX%U"=j%e0业佭@!`RSD0Kb+CM(%X[C<d QB J$h@g%.:,:đj^qc/6XcB )@5IWVp]LytAu9J5-opp'8G.)X-P~_Z S)]$TQ߿2gѷQ!˫!7X3i`V"@V>oVDpz}jlcND)ke$?KDrAQRnpaFah%Vh/oo!!7Mj /S{[Y (ԷГ\|ip4rV>]߶p~?!V5bv% +E]1_|?Nɤ'$ GgG 0#W` \/u.sg>鯦AyS)"wl/WB߶sgxy3Ֆ?ָ 7&$L -E hviCmniVu;6jœmI,A_ͽ=2+%GK-]4#//<ܕB`C-@Xk/g z0aU| wyo7'حɔM4% M6tC!I~d״э@?@,h x4$L,Pw]jJIm˱mp0ׂMSujy ! i pǾ#ծhxeJ\F='~P\7: ;7}vX F}Ckzhbu$9AVZg.ʚ6zo/'En㽧)Uڷ+.OqkS%H֧F <aHAZ$qZ2Ϡ1^D%FUO*GAVQOW8<zSČBν? (߂PpAP| "Z|]2VW a1 TL >tN(=.XQyA$_9ne b ަjASQfFlWlK/N_ˁ$ >S",PɪdceZY[hB.9;N4#E{n, H@$H m!J3Дzv X{]rBl|$G]zgM#yGrt 0n^K"JzSW+ A*T14>~F ߽TAH:Lhu(1vGMTL|C091CQr{&jM0":hwe^Jkӕ77V:k44~(yu_ L4OاҖDSZu43z eOPTgWZ + _YsbO f$ )2{p'"FDVwUAA/PJBn^' y''aieV&k5op('IΚ :FX«ZZ) FO_v;4tAwy3b]g?¯r@إӈߏ4`+OTa3 Ppg>fPcotƊA7r;K݄mEU6#rOZ~[dn7+h##G 0lAԞ 7$H7t(fFfjͬ!U$)p(TYu`]DeiQ32ڹiwo|em->x纚:|W6B:ʙEy#^M)C@v60K>i"ZIܛcRC$0$à}ɈDPF=E ;>hьX-*]pس.+sˮ@߲"q3Զt_:2/*)=F2yVh7ScKW"!ǑCȁlt)7$Ȥ[q@'nP@Qd39uM_T6RG}fP넢SBXmٔ40΋UX i N,WN V2EtE6gLBfc;F{봯ƚtNF.v ޫKQn_|_/x);<)cƏ#ÉBG\Z# 5Ł붣s@g+" zUaޣwx]^J^'BD6F9c)]7q"uu2BMg~̳{-8k%u1JV ,`|ٿcic l~@zۃWlse ɮ^\1' b.82uفZksX6k8rj=j@#N(ip@`7F0KUVA!O`{8J`aTV1xSed>^@h VS߭-\@|%$/cA &F(uoK7'& s,Riwk\2g_&-qI^!a"dD~z5d-V$:2J'jA{>1a8(Jߒ\ 9#';08Q]0N@_RU<yG:YSak/\@U]"*O2 Bụ Z65D3|ĸ@$Vm 2lLgM!p*6d(ߝjveў3"z}Ik9Er:GXu`E &d/گMgpX9)-k\`񵷯ZdL#hl=%htJ^p^4ԪZwʡ'o⽍͵I{˻F3]@kC]q=d?G\ȲԌ>bEF M|w%{c]9;#eFY)QQۺzMS˚AAnVh1T& A߹e{a+-\^s=s[Cԣ14DP@f-p,ee,R#G^XS?HE"wVuS Քݞ7 O_~aoreO}EwG{M*-XSAσ7ig>k/rڪ\>b´1jOfRٚhs tCKVԁ+tΛSG{es]̂w  f_կmqW_)p!-4a;'ZتՊL12yM Tafo֤חZoALl;`_zc{L\Ōdُb~!ݿx\T=cq"w9sDݗo9x͗@Ɛ-$ @,8j6zJ7~}]]4&͋^a(/Ľ %{Y }}P:|ksAd)@Ƥf/;xmIŨ g5dfMJ// ",5I'У tW;2Qx;ԳlGF~>qwɣ[̮▶X>Da J[-y! FM$W]\;vP=TA)xEsbυ,pM@>yE3wb81szԸoaK NJͳl"-pl]K' ]-bCg'B{{zX<3Ov[ĮXZxm][ BE7cI3Ҍ""׵3*KHѠ#adzDZ<˓af+#)zX_z@ GٗYev^_Pifߛ-U'*nV7}/\5C\s+ 1 )n !NA_d́WpFn:6liI(utįwhfVgR&~qU2) 5Rc$f 6{Y^̺|lnt-xw"9 (6Gdz+ohcg!.ΓW *_M{猞yTSz(JG=(C)h9i ` JLV[eU@Uҥy/Z*h Zm>b 8/Y 5XHq&֬k݊tu47>(77S{{u+Re&>[!+tKCsTcCe Ԕ^ZuSQ3/hN9jx wbkhJSUI^h)mzB5bPE{C7 \cyq{(zeIIIIRUtTJ FC=|إe!SIw(bsC),ACd'l!~ ':nt]< so e@LI7"mOq3ͅp!G 2zBg =Avi(L CrXQ:6q(oX3rk&OKki=Zo9A5]85*DU2&yd~7Ի3 .ƅ̠/ir7[Hw 2.L W n9AѴ30p_i3lȿ\ |gypr\2k~M3 ZkRq$;17iSf7V5gJYQ> fFpV9W%Fΰ]OM*|Zx 5x(p^|9_g^FeJ+Sj18]"=&5Dhѯ& (:;Hֺ9+ip O$jVe i E4x]sW_Q1*CV+zxZ%4nhs:@yD$ɹl*S~h59I98tA(Eyy^jXԎHR;uLl^Rd6.(tu;Mb*pI!:\巐JJC ":i04OWABAmWwo%9 ;hWa[g!N&lq"zc u_k:/lE-Pv8C&5l q(I!9Jg.lp)gj5JR&Wj>̻U*w>*xT*Ogg?BZ b:)I1|Hw9DO-B.]"KtBep8mX{/J#-vN)a9-rg2) d B,~Gf{4`E_ɫw4|CFQ <)j&ޘLs pqAu_u r!OfvT9vZb΅bʑ[7^ʛdʪN$ɹBly-UFH'8F [>G$1[u \G\{^HHnCs (/DH UUHrw+E5lm~GqnokY<ƙMLN{Tx1+]c\+^̪G7&X,jl\̌H:0s.$3 <4N4rfScN)x-2h>$1FbF {pŋ@7xts|fwIM)j.Z0u07hCv_ݚfR112ݼ 1a\Y),*AhYkf K:f V5o.LZX=pzZB%ԺZ~I"_˯Kù}5RP7N8t͈PjxӦsbi֎k<2 ֽ/R9v'(lGȸfԐɸV9a{Q ?k{&Ι A^t?G|WܰTVÚ5~=|[RiQ'/Wa ҂AL]zBmĸpM} \ ڥNXLX;8SWO/T4v,hpi`m ky}kO|d}l!huZlIv FbykDkOVqn?4,SQ 6SAi\|!Q g[6ǧʚh l]yrj]>iݳ럸j#|cK+ DLy߲lgaspmeV5=m&T: L$9> I(WPl y-7*۲Un.L*:\ʼn hG';oѷ[{;g.m/1s!Adoy%l[B5 ٬&9pr0⎋6}:NZq~ RX QVإ[d īa2¬iT3ьWtA6aV er" f)r߿ jl3 fz6uzfbSUJ *TJsvͪ0sѴ)#lOg :ˊ Ie&uc+Z lҀx8@kp)p0~}b؞ ڻT]bKK4C `v֙}hިUH֙lOGtJQY+ohͤQW(,u!{AEo*sj*E2z7Vegtx%5hLۼV07{flkZu-sBOxK86vuQ|mzNc!5KW%lsۢm[(;lu-qN?֊!TԢB]cvl9{[ omJʒ'^t|uxGpx*ϝD({D/feK4a5 qﭾw[#9vȈUb#>wlēmx' :rZ*8P5U ~@XI2ߩ$haQeQ$|Bj*oLJDC8,pQPxb<-zf}YvM򭎞m5 Fcѵe,n_T>ݜ#3:Ko;{j Y72_ %v(9c8?8bK%z<90Iւ\IRKpYkf}a7ب*UtZlTe4jSq`F`:WNƚ {R!PO;TGE#/Z0 GW'YoUТckjz9wb,v~Ϩ/ȫ!F^] hu H_?66_ uͼv_e䄼 }/H R0S|ej>T*6eh3w/٨QTOjE]V3h *ՉMхa茨&sI/bn\A x#"k2/,#ۡPv~r͏ -$-d(qPҿB% n%~"sTK:{ү\R@%K%h[8IxK~dd?Eo/LK=A|Y;z:sގɡyO zw 7+_띷bi}',*vDuF`cD8QVKޟeKџc{UbB|PV=SGjQ 5.8 HA@ :X[6y\?]֫_GOfj49Vhɋ mɉptOZU;uj Υ^mjVwq--l"/fPRo+^k4)9eigGͳ0 ;y#5e^ [d&e8E\B9$"WrH/d3XN}NaӀ;Jľr̯}061 5 6CYMh{}{%s]Z]mT=m+vhbXD[oKu5L P:]o34W#~yF6ۭ3b]2F a#)!P%Q $_N^nPoC 19F˕UU *C*Rc*o-,y䲘4` R R+*f""DP HpHOzJ=. 2]Z6m].z8ůI;C)t2 UC;bNι9%T0 5\9]ӈh`FVO ;4ysl+8-6ypM !]g%bJ;xDy1xǓFpQA+3r4K{B_6BZ_qT/4c tb{! N[ 5`o^Vvt|F*N) L޵Pk4FcġTѢ7ӹmȄkJrHXf["9)n$' B%Am$.!}GK"d{:h(\bG%r &$-8=m=m.:sjP*#u$K>;{J`WM)O.D$ 2b65@0ODh ڈDb1XN%6ۈWNZz-["W]ڳ`I`k7(wRB:o̯rq|%WoY8fε8ƮvµouC+ WfsLVE:&y[Z&l/DΥ餰T5f\?Lh~_}> W|5ߙK/^wF9xk\& JCe29؃?lS|6|>^şoߋȯe1fre~^t3zMt<_0mo?ϧItß鷡BG`-d|>O=27L/%kuBpD@ϙ~8xrUY Xg!7j1+;fuFŒոYwnlJ\8/94ky_]cxTϜ׶xu*^X$`kkFBI[=f^$ELJNz 'ӿ!DO5F0jӴzruV/d'?;,?3p8٠X \jz,F^O닄"F _}E jI?EiNKxi{C=蔞ԾO=[{&msDϓP;|JCoHߗFQD Dws#z=wHa~ ]9}No.>bC@41xQx"y>I`X8'Ļx"YNˏJ66gLI[\7HUU>WȬʌ16Clmq+8AL{a뼾x0T64PjjC. hE+)h\hH4*WQSKiTCq`π' GnG_9L('8(R^W# RpY54n5Y  UƠ'RXsJ8O4EJ.ᬑ6k&rZBYaR<,<ڙ9}>1 )k)?kCD)PZLYS Od oI+=zC e"wXҘ8fVR#히rGH*!Iyu$'rU]^- `&mL3H~J;eAV+8%p0tZvs{f@"|\uO&9X8x_:d. <4JW]Khi>4c4cJ2~ql%)&,|^_Bmr1;AqR\$#/j^RU{{Y]5))"D'a$ib*j7B,egyaϝ m|)i__j'ϴu:m6|i[~Y7D\|>FCf+/}*i nݰ֙Evذ[O&{s¬tyFN-[jkccqaF5͕\vG42`otvA2fqܧFpQF𤋤ZgR@p`0qRI']uj ݩ:Ͻ:K8ūSzS"j?A˲>>E343$z7ԁZyTe+TOq[Z)L( -* eZk{bڭ!Q/ypUiC&x4=q_S~RǓ{]s:N Ս.?W a~='-FRbÃ(wPKHu:Rid.hyHCBN4:k0##+-rj6~Via}=\*Fȧ 3Z< R{B>``'=_O :!})?"pTG sp"0L#;s]ꁇT&{zu'7=@zY1`VRWYSc;jbV.!ָKrU$â6Hs>)i;Ǜ}NB((-XE?\Y|á⪒_9;?e]NWitߍpv,dрvң ㌳d촼T`eBb.QL$j'!4*=Q她1_̜V9m\R"jw:2{6ulZrP**Vghaڌk2rUhޭ]ˬ}-XTnma_[P{,mn+\^6O-ㆯ Gs)ZbYS9T]XZU6pӲZ.Uo^ZUQN.-۵{ 5;`Ю}5{.['Zwe9_t9ҿجei ƣsCc; nqF23I{eSe=s1]fF*?eVF edffXկ[)AҮ1%LoKGeNYK/&֦MyN;9v$Kҡ$|ڶ8<}NLj>0&3CItы2&]OЂZvϣsZB$ћzIp9.A<-\˖uzhI9/;<\D3)*.,y(] q"`aq>-U3镥e-Y6r#D]bmOqZ x24r+v)**+?M_.qR9tHπ~}TWkJt/AڿU\/ Z}3[A.e/_~yU(_xᵹku=>~)N 6|u6~h u.6^_{pM.ؖm ~sziO,yk2q&+GLvn9jksi[nrpka-8ւ[,gt![hJ'Kҹ32N%i*>B!g!} C3.eJ%NtlMm1Mm3ڿVv؜m:G{C~ >]:Ko[lv: dU3q`-Af:mr ez\NmF;[o[^lKmc,3Vk9-GfUrl,aoϢ-,Ϣ-,Ϣ-,Ϣ-,Ϣ-,Ϣ-,i9ֱ mDk73 ΅ eQաf!nd嘩e:0ևs(xχ>HB25Ճ;6hAG*oGwV G Bfkq+zMwCC*uc7׏Q>;"q<]e%?l=n\BOPG*C^ûGlF %隣ݬ6qAzG>65}t\-2dUОa{ |> +x2/?!q5'PC#5A;@6O%LbAB!KiS3J/Fx<#ק0 _D(*"XH7V'[9ZU茐CE[a{GBܪȺ~zF\ U>긂LX{m_NŤm4,M}z$sb_ Fhyh}LtQ;t8KnspKܴG_"<;{^=j kYylEQQIh72ğtz̫zKu^ե3nj{q_gBɼ:}n~}nqQ=skt̫MT O94Ph1thcb7~$J'?ε3'tG-%籠9>ƽBܕ}6XUHtwN#R,qϯg{Mعz߃dkzbS{vs*Gޤw pX❎!}V:t)6JY8=,e;6"$DoI'l'P|/k5G(KqKW^L>itGȏ>%Y%LVHxΎ걨^B`xUsTq.}38e߳ĥjܧ"T+^/}/8E iYt?75lkDoNiƘ*ځc#Ői9=t H5]o.lOk4@['Ivm]?Q=NbV<%C4g j\iEòu@>[ ͤovkFZu=NZ0 k[ C#\cr?{GܾPU-Ia9׿]tBzBIk}ѶP/JT^>G{7v}A\ґm|BJyyzb7E{gK WG@R3!z#:mI&bDzZ=N_Z 34K M\CQ4!6u]ڍn'{j]0 Qp\ _4v"a<QBOmqj `h$̟PjTpBj{ Ait#j YOo0w@WLPSGa:4hOܥ=oT@yՀU'qxu:w5@ {0-aF#h|j8u}0 QA_8R6G^;:E԰(Qቔ7q T  AU!'(5,#8j(::Q=CRa7w vKԡ_0hsHn0 wa/\*cMuG0 po,_[9^߀;|cmGgÞ \0E[<%*줺3 FP՚5G)0+H(vGxhD yr"CPs!xmDBEya 7+UHA,65c?Be$܅ F/_b'ZC0- `=IAO`>8h)$ WVd{-?VA^r  ޹s W!C*ar~_ 4ףM_!7OGyJɽA1dեj;[jalB #Cw}kxo $o*l/WsBx]K<|kkO7rR]9X͉P"7\Smx[Qx Žq5؃7ȝbmգ# zPnQSxkVԫ"/UDZˇ­T7n1#N\WXVX#,˿!!SBuOԣxt0Uǒ"itOGW`(<c|D%[nyF%SUw`(~=ES~~&d; h/"آs%|kjP;v4͝j{GzRu_sWS۞.]7mjmRa{GCg֡6noinXsk]˞֝<چ]m*_PWɕnkBvGsKs׍jcsW+j{mGWsݞ}OG{[gҰ n+Ԇ訝M--TXAյѼKmjkoXVA,Pu-ͻKݵ;6h 1ݺ}M 4j񯮫èkk@(;kl(Uk;;C;ڠO< pWsv"!aK}Cm tu򇓅Ӯr >H}x'6_ }>C^Cԇ1Rb̯2~ax'aFÌԇ}0~7/-. ahjvJ f^&S%AF^tii\ * j33ij,'Vk oRfm ɛ8~!㿷rF(B*q$֢V;6qlgU77AJV/-⿱FrIHR'K*J$.nnG!aQa4.g?({dY';D"^TyC^ySU~'*M[ryH9/WO`_U>_`X1` ~X'Y`y` X X.`>` q`=sfJZ :  6> /o; A)XWz` a`=Om`֟o I'e'=#Iu f`mw!`='$>`}X_զ&a`X0X?GzIlXkA`Q`~X3: y)([!9K:,XwMQ` ` ~ XO0Jr^)TfP;6ܛu - ~{`,~ XI`}5H %f`}7u^+*6Xu#VPΑ+vyt{XGz~XOOU`W`Dt^e0+S)J+A`=yFmlDd XYMJc m:D|@> ?߰le# I^emz3(~X Y`}XÊ,T2UzF)GV+7(eOVXO=y`XYedC]+UYsrWYП9sf =9ד!Gr'fe6̙ tq'?=11jM_N91fm kfb6>1m3A~:؏@xW{'*uZv~fɞio |9eBvCMØϜ23<99l119 >ǹHhݢ3у"etr24><9mѝ1O8I]-^!,)4{$Hvʽ}wwis6YiR4YnƚmLUUkj$ 3YfEx9>)1cK6Q)쉨D'Ӟ:33=Wl̰Pe%X'x+tT-nu\Q :|fv||&2K]!,fq^;3n׵s3ɂ/Fxr+f˒]EiV[L"@ⓧtfN\Pщ'3.׉ḂQSa{ MaBhOng=>fHv @[ѫ!=ծ9L["Smݱ=>~)϶$R$$.l+%3vdO뭩g_OH/Sԫ=_.r䕲@#n1^;DRh[!9eh.68mw:¬|F)L$8pY$fLY$ 5+*V]ut%)zxYՕgI^QexPYMUq^3tvU#;mt͗46m&co*KVm YӂE⛬1YrXy%zzW̊9㢗cĸqyBNN3E+ǎqVaEi_Y޵U{Ot:mn73ai!7iB9vٳ^>m&+R:=Q2SΘvH M88[1r%[mHĦۥtg.ێ{cN&}b|fubvac/kǪv昗 "EHQ'D"f)Gt Ӊc0sXD,bviPi4jt^8eə&iӒ /ĨQ{I;9O ҄p%I|찍ǵͰ,9-jhj$e3%\VKR6fW+N^"QEwXxbͯb.uc1DQr5T[gg seF "kvtgF:&9"o˱Y޷PsǷsv1QbaX<Ύţ╡HYN̈́x^a g̘S=uNF'RGItHN7\RƹQ)eץE( 6wĩSbS<ǜ6H0$r?=i=<^\]dB|L%gO( )Vbv+6dKaJ~ ZثƂt{F."ŽUF;q"]#.G"EH;h#iv#!=%)E 7n4ED,$Oʄ>=+MZI? Q~fd.W:KgK֎;>~|vw˩1M.;n@KݔFu#+M=+wHeq1FqsHyxR]5?M0~<T<23WM' "XSLs-q9!aHjpQblMP;g6PR/z)@ əNu(Kr(~e2&9ǷKNiӼ-#5j kl黚4YJvdϘKeqA7 inԀieuWIi64YNKnYd3]QDK)%^ HD35f 43hd73?{cl7{LM.ɚAv+{/8ke_cc묊0yG[2;;v3-,u[!acb˞c/?'Yk]>օs;4eK(oULtŰ،DDTD@ !DaװȪ";k}w禀L{{ygMUwW[= 9v@&| ?t B)x5|/08bX i}L0P~>xB"$C_@8X`3z[82HSG Fz:ՠFW_֌ <)kMB?B|ta czTPN9<7b:RJ Pކ>|c| ^ 6V8[#,M!h+tT_D a, .2].$ \Mpg|$SWoұa 2cc kǷmCؔ00'0Ʉ?%GYaUzZ &'F80p۵s Hp5F­[Nl"#t}̂!Ypwј4׿Вn{t= wzTkjj MD >SR_|c{r #]P`^GF"2s?,>0\%eM)GR2''Kz^*m9mkhʹm/mi;MڮvmJږҶumm{m{j_U_BmB@ի)tok@`yhq:cI!J?ūUk)(H `12n;mm+mh^vݭ mgۆz65Գ m}mhņipah'0+?.gYlflf\^m^#qWqZոdm'qۤMwq_ŬJz7̝iX{3+zc}ƙڞFmo؆h7C[X|zS/6Cv,BۨyѬ7g :rfys#K9x@޲k ou6]uM98Py ^7G@\=Qv# zDjWc6Q{D]?qsY^E li\<`;iE%YtJkٶϝiҥu>ٶܵ}XI-FXm'8춚zOF>_wgu~)ڻh2Ut7`q^gZ[====.==H5T_>:=X4?=n@?6pUlGow ҀTŘARPnΕ]訑5LՙJ7:fԙ@|8\?7 FiXCzY4$/P٧\[[[Vgmt߇aq[i 讚ٟy5\ϫWxZzicEjցj9}LBhk蹗Hni&5VGɺGu:YhJMStN5%#OY9w~~&nL;ȧ֟^gHg{F75G}_OpE|^T%y 7|雵:/Bn{W^q|eoؿo9@]87ۻ(1|=>'9Cʼn|I䘃_FQȗnO?+8x@ q5<:xF8x #r1<1G㿮W;?G/(/rcCqD%l$`;6 BmWW+jjP7;b .gWUE"F%Q=B%),`e m`׀캈k`EhNAئdWShÑ&Rml'Jq5 lk$RB a+sV|4X-|8kn,d*"n:bȄdLa+ʸg\-]-YYWkWk#vurubpuvuf\[Yyu ;o˲;v׆_ 7WQTKRDz\=. b"T=a)WOE*JGTYUVV*Z<ʩr"RUPDUIUyUTeUYWUTU"JUSDDAL5T BVT+jڊ"j'PEQIuTgYWē!JG)G%U_SAe5]ML5j6P_@R} /j.TUE1@bC8"c8!NS8#Ίs⼸ .KⲸ"& /Ӏ&pQ[!`V5E<"I$W$d.`n"E| >1^PHl0߳g(=L#e0 F ϰEWܛ0_d?DwNߛ XFk5FxԈ4yr( #pnCke؆PF.#2o=p9#lPX 1K_gRVņ)[&xƙb& .ЏrzgEI,KDX*c: 1>K³s_ xv?g/ a<AҚ{EgJc }/(@a|CS\aQ0X\aL4a z`L0fl_+ _w÷=G Ȁ9 V*X kЏ6/ ~E6;`'B>Ȅp9 G(pN9 g,DotUunpnAik.o7[>7Ƽ oy3ޜ-y+ޚޖ'v=O;.{> ?#(?Ə$?O3g9a/ ʯu;7-o b ! n!Gxkx] E#X4m#~b+&k/F$~UlSWb8 Jfcfl7v;]ncgdAq8b5ǍIq8c5 Eqٸb\5׍ߍM㖑ev\!YE(cK|YVe YS֒UYG&e=|S%˷el(8l,Ȧ2__eLmel'eQ&N2Yv]+2E=GX}d_Od(rDar!GQr#qr '49INST&s2]~%ʯf_CJzX=^Voo R k5j[V5ɚlMZYӬ k5˚m}n}a}i[_Ysy7|[ka-Y˭Jk`m~6YZ-Vki[GIu޺h]XWkouwuʲn`36lG1}>iOg9}h_/W57}þi߲>1 s>>glϧ||A`_/ E===+KMMMM}EA{>;SD +w%Ļ>^Lx~1L bG(uq['(n wp"Q݁.eR W+M˸,f?s ~_#U*Ft[t;xLU (E%ATPJH*Q+cW+yU^Ϋ_寂nHy]a7C6n'cfl&[VC@Z^4d}?dTX"`Z40.3*ه?i&lD"Bx~E,dPJ޶S_+rG]]YFX^`{8+ÞpsOdO'?gO糊,ֽڽܻ{ػ})Xsm zhY-bO1OqS4[))Vy=l<[TTftc^@P-H+K` PyubPugqM`Aq6 S,-J Jl=x_&G ~\FQ ͓P_xL>6mF| g]#2ވ@=P<Lj u6'jm[>;=%9^%xV<2b!$?!?%?d\䇂 %?F~(#&^WP{L,Ȋ2%pRާnOt4v_qaawVGVGd]FDAD"*&;" cϗcƧHXީ }<|~Uu9uK"[FIb(eX,+ b-xY.bޜc>|,>_Klӭ%-תiXyݖ"Ͼ>1R~.ڠ]E=BC=RG}zzz ^\N7q9]r*q3kD1,>_#~ ϔ37L .\^ dO5|n._Akh t6SyI.zRh)ڳ6l!KYdnbB=\F}؃z؋zx(h;~ccA7ϱ,oD}"d+ڨ꠾15q]ԝ:o=$m6Cf[ g ŭ6Hn;$#qqpǫx p\PZ]> LUkD̓Nx>/NDt-qMߦQrk$c{ٞ4WȄ9%`_Osb"nC`1!8Oib]ؚeͳ[OVvG.GDF}]\\¶tLW|-MĊ"i$=  ^ 9x9x%x5x-f/4,<"DheSCCGBGCχ^ z?aB'OC>}™`8‘ppppp~I 4\nnnnnnnnnn. w w w#YHDFTDG.F\TԈk#>&Ye.l. w?GUAVfc5{gJ?~oҿḍs\X8Y̾-쇨+gۿqn.|ww=4ta=(x#{#(]Mm%4gC:WI4YyVU#]W"D=Ǔ=4)NMRZ6g^9vn|}X`wL݇)IȱG#(V'=N+ (iXǭOXBke?o3,K?kdgVIOʭr0u'U"z@%ͲzY1>~u}O]c9 S1Ъc<_5_/Sk#}/g*t>v,wv|po N6%)uLZb-rӗ1.k5?F昧RPdC]%ʷjs糴UNGnjoe.7B3 Į~~N87o 1w˛"qP'yT RƞQac[+i1_%$娖<VrT !:r/ Nb ZofGu<dFv=c4K3g#͌Gcy'Q]fO2՞Na{=س{ȶY7׾bj/Ru{j؏+F{DZ톹 d/+}W}UA_}9E_WuGfe.jf~TZ1e ʛQE T_ .cJcWffX7(-|Vկr?XnvXRNcE+?r؄4 94d gO:v>:z,G8+.U-bgEh9fgC,s(c2di岮e]z6[o>[Riy6g[vC9v#6nbse؜sMmιBs.9ݜ9ll1\vKs.ݚv.۰v;.I,vG.;ڝڲ;]bsfٜge76;ϲ{؜=m^6nM,I>IJ=\xƔ@?ٱZkpִdz7KH3$(fr}sEdKRC*bborѬXVkmϲ$-.PpXNY3j/aIORAm^#9*)Q,+TGIYYBk9L1~{+L-(;n(9dzI/ Yd\rT.%)C@#2IJzr+(S mQc9hW-øȢF(\!,zu}:ĞnhˌZj>%x\''L>_7 \s}O%-Ɠ"}qvA V5Uʲ>`,r{)]}tp}%H202=~%)4ĞSi s~%mStxt8<2zlwHO4F#QI֢GGmRH+i -GNG/;{I،|;cZ]̙O<U,z4|XS3ї/G_qOG}#jQx b<:Ό]Y{s^?.>gED1f GxgG>O=z>_2#Wr&rKΒn9[cy\'<-ȗ|MD.*P>*]eTARa"UTIV9UT}@婆jUUB]P=U/ufUnQTUjf{uOUjz@-POIzZRvCT/+Ucz]DTA}>W_/}:Mu{toG7b}=@ԃ`]zҳt~P/?Ћ&Yozޮw>)}ZS+>o{w}P/8՜N srj;us; <)pZ9YUX9=5DLPSLujJԃj1 W:v4^TMS՟7th2}Zҏ:Km}vH{/{+O^CNCɧ_8MB%kS#Z.7-UnSW>+~y@ayD~!__oE$,/+򪼦H ejjRT[=WK2\Pڪ^P uRNzON>P{k D覺P7u RҭuVuQwҝu]o$}.ӓ=U߯^W5z^ z>CvSű#hqbNqN Ǽʆs zY!d2ků!xld62 ̇<&DgI<*˥r\.W'J|J>-Wr\+r(7H^?jƨj&jSՏzTWFIP!uXQGzGJ~ΪߨsyuQ}.?˺o5:[ҵu\]O tn:_գh=Fx=A߫s<^z~BOzsޯ/o%g}Y_W5XIsNfNI:lݑ(xIIlFQwH,w;jbt2M`=}3ݙVsٗN?X̞a{i<AJgt2)s7uxV}7(cDS&TgӜ\N_&+3<{ƞCPy{ފ= YZW[[MS9㑰MߵV5#VF-LqMr:q&ggFٟvKv13 $$(/Pr"r IbӒc\Ǵ*lyl,CC֞/.m}ziGbxgvŗWAS:j]z|Wr]Kcu&ֵȳMDZc#P܊cM5772n :,: 5BЮ4@K|g[I0q݆^d #ecٙeO'X0ȩ/7ʒ9v&g}3TDeZR2y3n3*0k|##JI8⌣ed-ާ̡"|Gߔ}p3قjV5Ւd{#;NTϪՓ}d_j -Pp.񪖈?Vmk6~n?%n οZRSְlC7QVQNAg"戥5hώ keTZn7$YnD(n=*W1w7nvkEmXqME}\4t[EcN4q;DS*{{y&';D~e(dz,=QD鉪jꚞC-!kvBr?*fMF93Q9'=0li8R<ү+R,![ʖӵmY:Yk&ٛfy3OgO1XB$pYљcY+!'8Z}3'9.î1'8v}fpLȿ92,ÈřKRc2 (wtsTnr>gp֊uLR>?MFYM*&'Y$9Άmoצ؍(nlrj`f-m;6BQ&rc}R>-++Js9E}rU_呱QYN:/8n+p+,8B~=~-/_U,ϐk"m?lQ-H#TeҖr!68z-r$HZ8ZmEǩ؝[lnl.-/0أhHlil)[{Jcbixb"q xKH6g kwElI^1q5Uj1?dq6[m!+"y<Xu3l%E1yy)z=%bZ^L`#଎gu1Y۽=rI2yiM3#|k[25jQ&|uSϤ,,{Hje2&ΘX;:Rgs8R!us.8 r8;_P_OT||K% pň|1? e2X32c!֌H,Bcјc:jj4&V3VƲch\,'~~>ˋ5XX+5idYQ˜&-UI%yTTuzknjfv#Ug)C~qG ψ5yFB78f;<տ}NuD!|jg.&w;MVP<(ޯWĉ2yw`꯼Yy`flo%uԫ*žc=!7˜}w'L*sBr {ؗT97<ydw;yd9c,9 :xV$ M*_E<˝Vy빏F~#KP5xRuxVVyUmQ?SoRLb?s6U5$TCUg:Zeu]M]l>UOcH7zzG \=YC"&S|j| P DLֱ8xnF̐1jo(0 L7Q1~m$zBLeqdv_9~7wL5>;NA׈s>G9:!b#HX4ED*/+#wK#|M5&r+9LGl PA*5Y-N1qd M>RQݭH7ݯhAp6dh/KsL^K~^Fg3~tOӿww6&kyüNüagaG8d2Ub:1|7r'+\>F9::JsjӧSbNT9hλ?"fR%H/Jg3onqsqȳS%~nU;;'/s}Fb| 297 x.*X`X3wOZuX"SY:?9O~Z\R{= uw\ᡲm6ӍlM_Uษj:m6qSMM@j#V88ϰl/.^c@c>cc'bMqz )MʌTH`~q)R9{JRrh9돾ACyj^sQG9>Ƨ&Oruٷ qmWڪl^qg~/Xf3יG;QrNv*1 GO|f'>7_/ W៸l',,柕ng L?+hgY2m5z4pRcUڀE_]cRi0fOjS.ҰTAd;\{&U}rgf] L;UzDA:K[zG^"" *+UPD UEy}-4b/("|'.}3d2IIrr9'.ڷ[eB\O|**A  ҄DHc>(.,f:jygՙnPẉyb8W$D5\V޷Y(G@[ՎGGՁiϴoGl@qYQFTOjDfYV sL{=_saʥ~TN3$ua[ēyt^2:QDk] ⼇({Rt.S ]QWR:|*zUOg~^z~jz3w~Oo&zjCt>G}:'O3i޾*/]v Ϣxxvy_ÿRgn[msѶVm m+DJmeжrh۵[P7䖴ҭn[Sm}莺]tNߢozZm6Gk[hmG3ZoX%P-j@~Pmۺ@@Y;3cO9erouoũ =nh( fҘ`vrߤ* mdNSٳ%̩\X.MrQ8B*hˮg | _)䫅y= OjT-+ǎj^M"^ jP%WFɍQY:Y^,AZ}@!*p>yE37>iI̛%zJrsE5`*xZyMg{?WF9Q-0AԣӍi{.]6X;Z)3B3}7UeKKԥ˘>|Xq%CrU|V~ aϯ;";bxGy wK`* y)^Y^k˺:^[Uj6Pyy%+L=V?Gj][rTCuy^3RtdzPw!< Y{=MOY՛L=<zS+}^ э)AMmSژ֦5dz^Ԗ"jg4OR{ʬf@!s:oͷ3{GNyŮZz"<ؓP O^ېے{U7扆[EJ>#xȉǽ2-ڂ^o o}z6_2k+f2# ENr&+R /Y^}DxE̽V{YiVr:V{G|0 1Rڻp8=(x455'+i::GyH"]( kI2֒֒0yXG,TwqTsn׷R᤬v,>sKڱkG~Drx9FD[9Nl'R~IمS1)r:&eRĤE/1) lL>)cR~)1)?"%OLAϐI)/RrŤ| )DLc~wYÈEK82?G);Obx%/eŝT<ޜ 퐯XDMtvQQ ܺ%tWR %Ϲq)]˽}^4`5B+Y)eUػD kzL&0=+z7JsAKķ2j[ 3 oCbh7]48Cg.A+ 7w]Vk%}`;.d 'lUll59k4GOsu .Z?U־95&N$Ѵ['&'z;D51]JҚ=#c ]:ܟyyE cxZK-z\~^O2 ]Rj8J37*aŨVX1jbŨ6`oƘbomߝns_b=K bteGW"FW:/j-Q|uNFCZGPuԺ j]\cc#a'<ќ~i~. U ڧ2f[jƻE[ʭC#z4%[δ+my-g'Z/ݍ̛nr71o*1?2{P;pUdKn؜Wl#wиl^a(x}saqß+&:;4w2M0ͧ%1CxWVR+eޣ;k =^M1m芶]hIJ^Ѱ=g(m w|اӑcx՜2}TH->ْԸVV_Z!8="[./zZy~h)XNӿ:=_m ]2'y5܏te=VFjƨXXS`MSx^6Ƕ6Z|bqLx<p:|-}#²FdYNVdYM֐dYO֗ ec\ve_&ˡr-o]y&3,9[>,G|P.Kr\.WȧyFr|E&ߐow{}P~,w=y@ <) q8#8O>'vrSIr(ar9qPS)I;H<ށޔ77Зd -F##()0*011,Sd dY²,FJI˒$YZ&We)"_V,+SAYUVduY ɚ&]-kڔ"ʺTX^'"l@Ee#وf]#oPqKC%e?ُJArC*#aTV#Py9V rOD9*r2]+Re9UN*Ut&e:Uɇ#PM|jRm9OΣ:r\@u"ct\*R}|'P>%Fr\I3j"WUT\+Rs^/ɗzInVrL7t"PkUn6-$ߖoS[|mrv wQ~$?NrInȽr/u~Y<"-32a>')'S$k_(K:m=!ȽrqYZK/fJx'Ɵ/s <*8MR3c)jou*/L2R&8e'X^{V)`y`U`5`u` `M`-`]`;9c;|eq߱_W#`ˋ=V <;9y+Ƌb)\ |88p p)q2++O> | p;ww浻{{/s'?3ǁ?OX  vy}iv=poFuߜd Z`F';m=¹3y"O{qd&{3wtΊx)!6H(vْQz@퉉4&?&~ &~0&~(&eL1obĿ?!&cLHLhLXL<#&~<&SLDLdVm# gLd`&e`9ߞwXxpƋ$޿{!1 w{/녟䠠Opƒ^x蒔S_x^~x^~/ xQ/<^x ^x ^WSa:N3uVYDZhG_t9 :QzZ|:(!Jkm'p#:. t!}}袺F%.]+Jj!z=UwIn5Yݣ{}jWt5CTj )NI!5[QG\OjZǔy?[[񛀉3Lո5MH$I6!{k150ڤ¦)jkLqEY^]}v{9"3͌50;̝fo&.3m&)eJ2)gʛ d5MST3M SQ6~}Mklښv`:N 67njz&jF̛Xij:g3M42M43M \oZ̍3k3S4syJ[]::=n&n^7@=HCP=zX}Cߩznt[NވғzGOtgEw7nUߪ{:UҽuWV'h_?ZYzN׳Cz֏Vcgz^1D/Տ'2^+J9UV{Hk:^o/Kz~YoүWf~]7V/~[ߵE}]`5GcSһWO~}@ԇgsRow{}X`5Q}LgX-$}B?S>g6l^37je26ow̻=ͼo|lv]fcO>ot+x?6>+c߶7E^ϞQ}Oq+pX;58M)\rEc3cn(}I;;$/sqimOt=,O;fxWh+mh/$Hʋ*存3hϤ01FStX(񽖹i^ bXc5+kw"Us p"p%C4mw̒l8ܽ FJ!8MyhwNz߉^˜K9^mdEl߷va9x>#sB@kG핐=_h`,$% J+{% J(a0JlKaounS+殽GOqwwߩ\gxpqS6;Kiĥ111111'_ccK!hE5>\yy2E`y]U #.qqq<d;Cz߉^˜̳#6{ɱ~ZGZ4Q۱Wg(O_wAZAAAhiq9gy ?%J.>\ |yO#~q9@{ NS;eNS%=MXq}Nh"{OF.?)KԦ8aX3gO Ak\kƛ ֠5GUȻy7zy7"F݈m+҂TwCQ t`ߛL6΢:wӈoE5s٫yWp9\}W缫Oh;xקyG˲!DSs;>ȜXxd Gy;#Hei@yΞ ٕ6b(༘b@lE,Nk+^ PJ/8 8/&n\]8h\s;W\!z^I.1^w8hW H 6%w,){x;GN]^Zq/e$ ג$Lvmwזsrw~uyC_i!hkSp]?nZμ=;],g+~ïޯ9]ӓH(?{zoL.rZ\\ Llj˲ta?~JTP (B]^6 U> w<+|}]宎rn"Z(ϴŎeJu.mAoϝFېEFE"Hr$Qq#"#WG GDE2hTUBHQc}3OT#7SԚ'؜ɟ*F4A*S|NW ҕsSCM'Y2rữ(_5 SZfݣYКp.P/|Y1uvSR%A+(_K˺GWTz>ogCsIV[Ӡ/9KDkcNvP:qG1 OY/?+yGq? 'q<=Xp:<9INN1w^aNt sSnS)ҎK.xY,98^y|/pxFq5'x @@7 4#_y'S9> 0#q|l`2 qx*ȉ_$%#_RNI9)3ǻ$u~%uOb YϾIs8`2{3Q7cmcQ'?{G20gy֩3!n'u9nl|n7/}cI{D)ȡ`Y"b,K,K,K,K,K,K,K,K,K,K,K,K,K,K,K,K,K=Z+4E@_$@k$z,Qݑh8 IN=H h8)I~͒h8~uqe& {qqz' Ёq}M:( <\)ؓqZ"NVKj8Y-'%EݒӞqZ"WKj8_-%|D$ϼU.wHp.~p.ϼrF\j[<ˋLjc4'9g*LjA4߈>iuZePQC3^MM7BU8wh؊yrs'c=r#nJxDA)?Z [Kvm0mc*`` ~7ZWqN+c޸a[XRm4bm[ߐB۷>ŞMgf!sW piEGJtma#*ZV":_T6%8݁1 |xҢ/Xx-)> V? |TgwMv7͈HD@I! r-\ ED\špShR"/" %\Y @êC.|9g{gt\&^㚼6&}D_@('A!be{uGׇpG?Zu@ce;b&:Xs k+F`ghllCviK&"k'd/z)B<"M})w7cZaZgTf:cd922/65o4no5߰dG,\Κaef=cjgeb+-ymm{}s~ EUݑh(r,w|8cɈi34fb̘1+c6Ĝm1vs؃qqq\ũJ|Gů2\BtBvB~Ba› ;&L'\OILNM8! 8qE͉;&L'^礐48iBRARqҊuIv&L:O<8yBrArquɛw&L>O(J V&(JBYlVv*_qf: gssss>28eBJAJqʊu)SvL9+9V،t s35B8۽v3umo <&Oh}Ő9y_h=8z=*IجM&@z6WXã k2uNVڤFVk=,>bos]ZEږGƞҋܦ=QL3.+^lʿQiQ-jӝ͕vc,,iK\7('m1 Ҷ͗V~~[]exS 1GZo~qTଧ$S)=v_J[&iieb|6CH+#;^iI2\ҞNA'q i ](ji?vBgcO5tF51̬3Z%tVꙐ'Xi 3-vrt I+W§D`Di 67lEOHeieIϤ,iVF3I~VKZ.[o$vѺ(_8'BMb41e7yiiTh*6-e\N5m6m7464743M9cV̙6lsWsywr%y,Wp\'"" E2GڥҾ!}^Z ]yLZՓ>6r ˂Snɐ4+ViswI+7q0f43fU_q)MzM/2kCwvZ' lQMF}Fa O 1tÕoph .~t w}0t\]-uʼrw}`kf osa3k˂v9hלlL0E7㝌&u?3tFtǚD=z537+_Aѹx 7[i|*3Bfk2>i;rCr*h<;voپl/ʓ[_|?go2~Cs ༦Wf2#IgcȝgIΣ2Cɳc\yty~X%XZ9!v\C( ǡ2 c!ʟ7chS&O  7!sn{p3m>OAh}|Uh8'2s3Bw̑˛$d1?y0t!X;!xx}wϣ<;?O6G {ds9>)">>5'շVVZloH O ZV/j?ɴzƿ˼-mYaaaaa^aa~aaaذ+>%>-^VVV/ Eaa° aeau}_s2q0w2Ef+mxDa% z =}Ks%{ӫdQoSүX;6ޭ4Lئ-=i=V|v&k(eJ Jvv~~罫w{OS6gGgoؙүVɲ.]Nv]`snC䬗ek9dww8K[RӫE5ӳ^FEʚއS}$gq5"ѶzG jۼU⌒3hQi[ RyO:D 2$0$04sh5r6jp>wi [o5JvPg+("ɯ>~kG$xv3>hX_6fZM;m㴍;\9Ybvٮ3f~aٻf];99ʜs3'N܄mΚp{)^8p[yϻ.ruo.Qm+VJEgoz{ OJW+7iZ ԨoMT}LysmCss3{̲NW0FtPDZ?{368cZ%yz\5t[R_[iզm֦5)ь=X}I6)rm,?aQ14GJ/{?)noo&&EAr{zt^ Y?ĭ {O:F)֯Ӎ^Yg={zԔWb'iJ?7U0D'ܢ|VbԲ&>s4q9EoV7q7[MBl3(ndc\YF-gd={=M'2f6f=O'8Z꧱[A9.#1r0|gg o׳,`MXM_j-C͖"2V[h-_v̝*w~h00z2V;&b%Z~*F&cY)iтi9R |#"hOOza3MIܿ3}exx[X]rV{rNt|#:[sVa DJD.޵`4(ݢL'a*NBF5o=y(^b) K^W>=o&ML/rLaQ0] 3x<2FZ1IP fZh'=xcp_AT S"=2A<i{k;lqAlVa}f³0O;eu+bcXX;^F Dz &lX KE]x_dEm^Zz 1~0Oڄȱ)"՘k/̶̶A̶mmm̶2m#f4f9=ZZ2ϾvKg1ȘgiU-WDۤI?Gô,S==$qMzK7zI/+D7FyFO6<.>D,$sɥ3~t(}~ϓ;/ *N$Z?\Z.CX"nƚMʢzkעC Qa<ڞI?i΁B?E^]]xCkU_7W.?བྷx1wEQEQߴQ'( 0Ư (UEVU w}ePivQG)$zJUa++gVP[,?eu׏cf>fcf>fcfh}vvvvvvYg1fLyg,~ o,Oh0k|Ǭ1k|Ǭ1k|Ǭd%(@E*P.j>TV(Cj5~_#׈5'~" " > >#>cQ2le}MK"ncF|_cj}o~c'I}RaT'I}RaT'IO^^=͚=͚=͚=Śšššš~ϚdVf+YY&ێYKS?o,-O@"ѻGNSaT;NSaT;NSaT;b%kXZ<ڻš;͚;͚dS7Ma_SX+m {[kMaffffbb_a_aggW2O30+?OaSPjvI收=kvk/Gsw=s(Yr1]ïh}VdBjY<{+-r-hwZ0NYhp09҇Vp}zʢmųk/x(gYa+>hX}醲RUsϊٿΊNVNf<), D.x]|D .ȲY#bdY,e1,FȲxD$1xRI'TxRI'TxRI';<ٙ'6xxxxx ~Fy &n*"^>FH%llllll߿dF۱`=/|cb hgԪZ]ZAkh@[vAyݽp?tޅ{=mr#hv6 VhɠhUNHTHtȀ; 4fь?nh mSg ]|ݡzx&yStc,Eq7SQvE;k3iU6|%k>~؜֒9Td23[,`(7%B$NHTHt`.p7#"״p/dCA':C  rz@.^=x£`0 0 0F(c'0|Y`1,EX ?e,uViWMj_+XK5w]xއ7z6Gnh` | [%v_`7쁿>(pjdZH-Y,YYt2.@:?U/AƋ E"xd2^/AƋ El.E| [{#| /%. C">0H'@*A.Y_% 7xv[рlVk}{b-1[,mX` xrOi}ρZqZ'ٯW#P&lYgq+*zzg{?9c[9c[Xi@+ QqڥxHDHӮFCpG%T#Ȃvp?:c@W2o7Fh@D l`@,A<$@"$A2(H4H 2qF3h8V=@Ɉ#;9}gL\ݕB733~tCxnv5zcʽxnL7hΕ>w!,Ŵc͓kI_oZ5|H#oM\SiwgiWmB`3 -M mvl"דE<ټƮdKZkl"nyzUYex})_4~AX" xB> `&̂BxISM7T|SM7T|SM7T|SM7T|SM7T|SM7T|SM7T|SMui_;`Capk|WѰ U ow&d~LaZ)1(տ&|߄}{){){Ha~`\q2RUʸJW)*܌܌*3T8O0*FRe};/tf:+]̮zFW]btU e(F7ʸQƍ2nqe(F7ʸQƍ2nqe(F7ʸQƍ2nqe(F7ʸQƍ2n"PE@"UDT*qDE\hq(yqx?:}W}{ :VG81h#81hhhhhhhhhhhhhhhh#81h#81hDsB<^N<| )#6e!?ڈ' e_e_e_8G(ceq12QZNCe\f+DA4XxHDHdP ) ipVO a=1'İzGwBOAox@_a<QOTx tOC<3Ya̅Bnx}"5Q )$L`L430Y0 UJtU]DW%&g~BR*]E,b\BKմ+uJ,EZ3_̯+:@y%svppptPFhTF@htQ Q Q Q Q Q Q Q Q Q Q Q Q UQ5UQ5UQ5UQ5+R cԱBX!u:VH+R cԱBX!u:VH@h|4>q9q9q9q9q9q9q9q9q9q9q9(GA? U;rߢ\=գ\=gG=\{_Ӷ%P ֡`*֠b *Qя~TGE?*Qя~TGE?*Qя~TGE?*Qя~TGzTGzTGzTGzTGzTGzTGzTGzTG%?*QɏJ~TGTATATATATATATATATATATA 0VR Ѐ (@{Sm D6             : D4@tNi W W c0z޿8vaFX#^h45&ԔƤ X7^ ^ " K1e7"+ː0dfvr%=䴏sxGof7Gfl 7 D܀q"n@ zh=@Zzh=@Zzh=@{u Pw0+N}:'wG{tG{tG{tG{tG{tG{tG{tG{tG{tG{tG{tG{tQDK,QDKDCA4DCA4DCA4DCA4DCA4DCA4DCA4DCA4/!ByʳP,g< Y(ByʳP,g< Y(ByʳP,g|Ɨu[?^e$K(q0ln%{,cKXǒ=d!_7{,cI{)m%w˩O1wZ=_nT˔\o+ Κ8Y޿>YαwTngx<;Qwywwywwyw|/{)K^R|/{)K^R|/{)K^R򽼯ʼʼʼ,2},2},2},2},2},2},2},2},2},2},2},WVPjsK%sIEӶWfZ_7vӷteNiPk7]Mnv*6tеtk];Avеtk];Avеtk];Av2*2*2*2*ӽt{7ݻMnwӽH"݋t/ҽH"݋t/ҽH"݋t/ҽH"݋t/ҽH"݋t/ҽH"݋U+%nT^_s? & |";/O EAkvȸ6W/buZ,CEC{wU;»"ۺvXQ yWx3jtw[ow>]xWֻ:w~ϋzxN^Tt]ȋ+<#v򈝼a'o(2o(~yNy@Ŋ,Vf~9;:Zwn5,Śnׄ^ϻ~xpu|V]xbYycQx;W3b.o(wR;v>;Pb%vڵflțȆfW\ƒזxC 5 55&01q>'z~N__jh5_sy^1D7^0S(1E婽ڻql<}ÎJ'&6r| #MrĦ(4(47աz~<.{Y`˳殦,2 S<UUO%u:Y/D~_#}y罫ùc{=}׼?+AN:5)wne֟kgeX!ZWEվ吵t+#*n2} f%^ o펿Aͼڷ=A5v8 9].;jyx/lDu jQ[I6RE}W"'>p0x%z8qdco&u#  x񞟀(=*qSWƱ묶"~<ْ89'>x s<4L$M"V/K\cºgch(*B&d/K5LƝ;:LTL|6p9?H8b~XXo\y3_(Q5JeEŪg9-Zk?e^_}|q굵xk#6zb f\wKhT{A[^ネ|1~؍bx6`c >ݰq/<~| c]kJ MIA^C=<,{ÛMMqA8x}X(Q;9GH| G=?c㏼&Fcn EۣÚغغ.܍{¢\H%SFdQMs\!y5u?x^a\ >`k.V+e~Y>|!Ϋ'9$ojJTr!\|m;_׶2e7ɲkm2k*usZF\M2.ˀe2jp eYoZ[-6bd5X,*ސސސ6NdM&٩UvjZe7dM&YUVj6Fkd &,BmK)tE%3 2C;Kg,^VYj=K,&W"~_-W"UM}h$[E&^]vQnWz3@t()-f"ev/jv] DK]{ٵMٴYD;b>[Ny>g|[;yySg=jS3oCfZҪWW/OCY@{x-4ޝwc qe<]ag:,oW;{^tսjue{ժVTN+괢N)[Mj:j^UtFǸSu.n{0K|OUݭRݭ3nO~wE;&wΛh}{o2#l :^α;岟ɸe܍rC2ڨYOo, NQ^pF3nvf춓(薱]dD@A&c';m'b(((Q|k{|\Be\\Vnն<~2I]HuUgճP ;$;wȝrg%7wȃ]mKo6T*GǻYʺ=w>EAzУ=ZkY>=tan5XkXb KX4GwJuU=p:ܧ)c'}joO>]Qۣ3W>/c%,'gnw|# |m^$N SU,8K(oUqZWnۜ 謰2zC=%:KV;}2|2 >;U> AtwpCp4A4>9m2>jzgt\jpz~=\5=gMQj>+;YP~< y z^l]z*z<*9}NYS8jqO+<ϝ/+mE4_m5nά|6+үH.|NE-4C=4,ҰH-4C-ֺ[hXaEniX4ciXa0uRjQ*gݛ;KN(F9j䨑F9J(IrTQ!imU5NsU8"^ z[g/{KFgG=tC2~򯍏fGe]8<]  x+<mo眽aj4}- SkN 5'd?ƩNçq:F p6>?gqy)?ysk|%\/+]BxfEXU"Vb^XW*ֆUG½ɹ=`5!L`ABCq>q½Jفw½u'l\ Utªݡ0gs$p"N8K_Wp!.W5|a1]s;fq?5.<ɛO'y;C&yHNT܋ic:DLr&񾹘dŃ6 5(Nty=X@w2uuW F |ǃutO֝x㹎#M\o۸",9ybs:AO6\U&c:f`&[Qz b-^`֣&x+, KG|72ryb<<ړE`fJBԇ&ILf5Gےz^׋z^/yb\oҰ8܆!iTOzH<-|ǧ[Az:ӡbmX["֖%b]S=bnI==OEI ԡ QvtTMsSs1:s>>s\>>ύ$~>O %5"j[a&dљ,̢Xt.ce,,z7:UVªSXuk?Q{ztj홎__9_ 3kEc¢-=ەo;mW&8$3Nn҉7avvDG' =Mtb"_Uቷ{trlttrOp u7`<&hM/&ۧ)}\3L9fҠ`e2G~4h_tt]|`8)L;t*LW9c1G#̑?sRuK|׿=l߾_.26SiS>W巷fy!T[ |N4fL,Tߋw;AS*;}׾=Ԩ03e_ԍ7)q7)q7)qS0~S~L ,)A:|  7f܂[qn;q=~L ,፧DG >4!uꯘѵ?ҲYZ6Kfi,-elҲYZ6Kr: r: r: '  :N( :N( :N K%ʒcr|W_p%[u?õaF.MGʦ#eӑH4%dӔlMSiJ6Mɦ)4%ݼWwn^ͫyu7ݼWw2pwdiJQ7x=(azQ;ٗKe2R}>QV(O'Y=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgk._iȨD(eTJQ2*QF%ʨD(eTJQ2*QF%ʨD(eTJQ2*QF%ʨDDYbYbYbYbYbY,bh1K%Zj^R5#uQJKbCUtyG%KךiThlt}#jGcLV/_w]T*TD*,jJ'օU*R \*1lSv߹|= U.ʥU*VҪ\ZKriU.ʥU*IttA']IttA']IttA']IBSx0Rr4wZ]-hJM)U4Tє*REShJM)U4ό>3gX3c}fό>3g8+b/P'U*sFef˚濬/k˚)!gJ(r*AClRșr*X| kdM*H=mj yq]"U"gș(r&ʟV&"Wws?^C5et#uOgDM9HB3yL9G3ytcucucuc:yN1b\V7q݄j$2:LQ舺ǿp|ɱ-22uliU~!82:Y,b^n^ɘ[ύRfsAl. 6u)K ֭LӭLP&. q+q~`_f!6;fX"wU0y"6OX4Q 7W::"6[fl-bECCCCVݵ?Mg 'SԸO9~^ie ~9hƾ(>Q| Ws;WJc!S=%S=%S=u`*YSxSs1?ã&r> `C q܀qn-Iv܁ɸwn܃){qtLl<5& MaH%eeBMl:6#N7`<&`\:}-ޓN 96?csl~ϱ96?csl~ϱ96?csl~ϱ96?csl~ϱ96?csl~+V:̬%3kZ2̬%sc̝9sgܙh TaGힰͦuQ[ȩ` pff3\d+*S1?eL)63fb3R9ٜl&i6C4!b3BDcs@P?9Oh@+|F[g=pFco7Xco7XcjIZүz/t~4xX1c>)sö 1lkv4p >h_7m u=f%:#}'<:.Bt$}_KXD\>:lNlFнT[ͫoEί~]>CQg#iEX{>oʙѐ TE*Řh-ezLn)SZJǝ!뢣E窿ZZzj٬ZWAӸ;*FU?S;*?_DnRQXڬC;*l vyͳ+׳ Qh*RMG%. /'.Tl Jmɱш8\\p=nxL33333Tڢkakb(z!lrVmNk\{\}]eK/5RtM\Pd?ˇ|50J xT՚83u$ 6j啁B7|HZT[jmK)DjS))A|j&B7@pɅ]' W%brB~sSZ4K !ܛ흦oUPUC#=Z~6uV#ݔd\9)^qVe:ʭ @ZM2u+ hꃦδSTJSHo6ΣT CĴ=7k!қY"u|Eug W7zi**dTPOۧJ'+Rѩxێ{GAyelx!15{gժ}ų>"Z/669@N\ Z5'\< tATEI-IvTuQ+j;Ptu@Wt@Wt 5qac_fY}fU432S+ցڰ;yvw#ߡ[o ݪGkt o-Ձ\]rQg,DԒ.3`s_F5t#5[oH;m}4}BSiξo(}OKiexrY<}jeƴ]ˮC&ڲh+Aٝ#`?hF^~l4~5dY-sx3v.o[yKޒKX+~mxv #]ʯױ+ Fvv~];{uĮ'?v| =a>X/ l9l_7)|+ƾ.6Elׂl`s^ċDP$$DTURQKf D#J%lq8ME3V4\RbEkq1KqmW+6q勛ĭlh+f{Dg*-zxB<}1\$&x')b $x'"[l Dм:IrNkɼ3r~rEZ 7Bw}Mpbw _pW,7:wq׻wsy[=-rx_|T2‹dLB&dT!X*]~OQ{~oL/ ?D/pl%/H x品HT !"AT #+_娠oW ׃ `hwJ0\N^ ^QrRz0V~ ޕFx$"$FRHHucdWdO-ƮrNibz+ǴT/@m׻]mj>&ި7b!F[Qg댎E!Uemrgr`〭bKSc'gPcҾ_3zbt^kڵ+76[Рqr L`? Z]`r18lGX]rcy'W v?)Zv{[صf[o}zѱ~5kt5:߬wv%*Tۨ5bxt}ߕԨR- ut=ٔ2s0it,O +7ѹ =2j/eAm񨿶H^?_1G.58dFkm7(}Zfe ͌w}~P=@^upjONNh"4PC{3kO`_`_+ѭ@`=z1ؾԇW<Ӱ3|#D5Ly!Ey/5L5L/a|"npAI#Ϝ5ؑFn"͕d^N3\A?I-57-0-QQ7rc? c?Qhh(OOTh'*24 ɤo(+E+a(v'[a,j3gk9>ll]fv;c8 sIp7K07z337hy4Z%VIh4Эխtk.ҿ) Kw)~mE(ry5)kWv.MC{h?եbe%V/KL !ho3ڙEUJheh6hj5UXMMf52\SeA$+%CkhvJq$UQ=q;>wB[mN6gsV:k;\zg N8rQz_}MVӭާ[O_AIJu%U*rT=j\AʵZR:uy!C7~F?7zK;nSSjS]uO%*DaSuEJ7Սz'8?>F{zH :^4@z`xPNP2QMBՇԧ 9UME|TԷv tR-QFL-_*VemPڤP(qw,PZ K$߫s*}jUV~^W+Ma#np{#G`8=pp? cЄA&K SHS^Τ Kx;%|!aR/9T_㯡$~.S@fķ[@ m6w /4/.7h{qGaהSe\;HJ~(9aA@ՀeT4hTVjA:h2 jC6u:ExtR^7156 v.%$`Rp~G"> ',@OϱZ } %ʥ L>a/b_ž8}U,XKؗf/Y<-k}gc]XW컳?Ǟo n2v c"g1hXq+YL~XpPC<$B ڊTMEtzh;H7n0C%%KطPoYKxlVE?/Wh`oLX,s-H1X&ԍFoR7ҠXE8bi@w[ {=wR7,ꎔ@4bR,A4Dx˞VB &,ũAjr^DA7e-Caj qb\E7^QcƒTo@iNXK+t"MEܠR׈R 7覀n7dq-Zŵ*R,Z\KV;2l-Ţ[Z ńE"HŎ]PQlP#!BQ`ŋ@D R$)A h FTՑ^#*Y`10u|3x@?Pɢ'VtE"yMo&x+7%4z1(mVdW"̵g+Ůz?tl{0v}Qxo%;UnGwhe;4nYKʶY6[undPiG}[(&IRb[\]ozAm8 (W/Y#P/fG_֋b^"]Y\SGBD:HojtTPp즣>8 -yP-fh!Tm+YpbrtLG[m.zB<8FjAl+_e 6'@@TdR?g 'f (u ˢOtg/X;ӭ#A=Pw3$rYaGjh(;gB\;-Ĥ7/=j^ˏmΩ<(Mw?7_IdFXTFi1M[غ1VOe>R'ٷJ23BSln'v-xu~DRO`ct>ϵey1URE謴yO0K~yj)r5ٱg*Y3c(igg C(_XETi{ 9Y iB_G D2;bWWڳ^OpĦ~sHiֻV@.znoC)X0c1 q>;Ix-Fo̟xʊ;S=я bvt,ų(fйY{sHLNo61s6?=!5u31[˧J mQǶ,T@β?i~F{x6w+yg{ $|pVR.o[YKCfհx%T3o{X#o`3:}P6>S#8KZΦtCTH{sRFuV,fFW5u[9*6[7`zD+rcj[fV E=Ve?}mJ\'6} gl-nN2 oObO=uQB iS9YF{,ʿϭpm'eF mRL̆B(-yJ?-މKm曇樧F( ;ٵ况{8 A|%]}/wn8̭B+ huǧ:"׆XS4"]; Qs-S bO7+ZvhәzڳhbM/|ǔk/u/A#}~|(_Ϳj}#$*sŰN31.2>1+[+spGSñuCiq H\m~7?/!m[4E/to㉌ժ Gi(=B6PO%Djcu1CgrrsNs-}>M,}M*K2d"qt_}'B?[Y/[u'};bM|cz}&ZZMO ǭ#e(bgSqOcޮif 2w;ho׾B.]c~5UPVOGr>}~#"E߯_:i __G 8y%n<ȕµnv1itڟӷ;6wi,:ZBZBOX[v; aeMփ=G# 6&B4/O!f| t5O39)~ l| '~ -]y7Z >D+x>|Ŀ_f>Ϡ--|.?y/ /i7_ʗዀH_ /Y@+2eyPX/g/Dh+ڱ$^o/Xê_=3ř_=.㟇c{&i~㥇u1^zXO㥇=nKcKEY㙇`<3{xao㙇i㙇s㙇 㙇3r}㓇'<ë<<\,3y㍇77xy2Wn-7~hk7~û18̓⽼潽x/$K^u:ګ2sx???k^S)x჌{yƗf|W/>#/>ʻG_: ם5u[ƣg<@o  {C{ƣ`<ƣx_:|ç_:sKa|//>Ӎ/>_ťťYƋxsx Wxdx wfKq#/n4pm~;>#8yGhሡfgx G|iሯ?18b#8b#2?-~3lDf#o6bf#o6bf#vFx?"$GvEv9n<3Gg_"@xJ  )HMj@t)j@gGg␣ƾ5ԋnE7ߢ[t_<0vnOw#GuE9kMQLD J@*@CRX"jKc ǪHiRcֈ3ٙLy=z^j=ہg[ =b9HSS6 ρ@4`jƆW\6"lM,6¾oJ6ͦ;]~^hycWZX#-^l,-VG}> 'kYDeyӁ-.ױ\ y@@/FW]btm`OuEgE@Tj$D!tAmārLRľhEk/8=p);wvWo.]a ޗZ:O:هP uyg$Ur^uޠ7|@)$g2_55c]` 17.r+ l?pK]J]FB.FHr]I]"]f䠰9@]Ow%`Ds7-VnsQQPV[@UB.tw nw7$A|"Z\,9UB:R%qH`\zq2D 0 K@th0VQ<ƪț$7UF 2]V d-kPG}]YdC7(Y!@LrY,ecϖg#9pk*ls)dEB@%([Vp\y mdRzyf]v@wʻP^$VBɇewC ܐ^$C K_$<%|~|16S1T3BS F:RTDߗ(@QcʷlYaD ͔$P~D\L~S.K9 3W/53c?ʹ^~(f\IŐgr.K\&ѹ2Sf" _)W* 2|ˍ$7>_Pv]gG)f>A`> QJT)M%jRU:tjѕ u&PgXMs9T5e3 4sqjK(uOfVfUWgugWUfW"6{l""b-4 "" n *#0qW9qG "t?bq{_>q"䉈dg* NN9..E}TSERE HRPP @-RP*Ԃ@-E+"ZPLh 2Q"Iɨ@0lȹ-tsBsHfPн.(i-0rpV`]4(z,R(B_AסQXGZ+#u{IB<%xp>89IqN<'.msWU]NZR+vNmԁ"iT4Pƒƒ F~Hx/C~hr*]E?ތ<@N:j깵OR&O+ z}ԱLJJɷG#}}4G#}}(Z2cAXԹξО`O@$ԩ+P:Ş*gMFF@g3AogImV{Գo9׾=γgb{1{),W`+핐K{j{5@{ Jk^'擦|K foG~u6ٛP3boAV.y~ EP EЗ~ރ:گIc7oPs~dGB;;λ==y>O4Q(Sʜ##GJh s"]EDH={/XZDDH7D JT!Q"Q*$*g"I$gkeD!E)#<߇)/ SĔ1edQLF=03_TQLF=3ɨ&z`3ɨ6zЋQz3è}/\Ȩ73En@HRDbIb/kW(\L+_o͐m&P/[=Xvt]-]_>='ݴmN*:;kR׶ ~ \q\/~!kqk!qːGt{9/YEKqѶԟҟv چIJeoo*[_?@롶-gpT9 ӿ@^EhC y~ y!^ Ɖgh0 y3cF40r\p[1#b@ߨm_FC6Fg-ȷ2ICw _lK+\ Dm@ҭnF7WH51/%@y9p `beX9I1 X\`=)j`t#bda2H#Y#>+Z&.&n1#Abe8/(|qT!DAI[p7H ItlO QGȵ5Jk0kO\*B͎VGT'jGĠàƉA]bP4AX \"bbk|/k_vXkȲZdYBd$dm6J7'QbNVk+Z)LYDLy10v}2IdّȲ^^EXA},D,;YX AˮėEė/__ֲ޷GBUsKpHdYLdyUiUJ 1e 1e'`BB45X?XS HLٝ+@"D9s@,%*ފx+&،b3ފ՗VL[1лb2ͨ+uaԕ~RȨ+b2ɨ+&،،bQW udQWL_QWlF]1uaԕBF]1ufԕB_QWlF]Ǩ+&+&ufQWb3ɨ+6b2ͨ+&bԕތ0JF]˨+2J?F])dQWz3J_F]狺b2J!bKWn (ZZJPPk)o~P / uRPP1z::ANPwޡA.~P?|t ] |t ] #TC=ɡ HV7nW~B1}$cYC( - -U~B)в E:ֆւP!mD+3t =zu = noB@C߅..ЕCIN('$Es9a#Jr r P_y=EtQx1 s/ё^D2^N=/bsȇ0Tb9&|tALJǃNO:5<TEcEs9}s/ιsg%H`0i}%җg*>=&"?ɞ ?͞77s}+мOhI?9 o92{9JWOh ?ᗐChH CCC@8<6E-=:CxsfoCW~B{KK(,_@>-{TA?wOi!A,CCvḅ%* R#FA(H- e3qP2#eL3#v$ !"%5b,_EMjEbIM;n$RA#(5b& RG(cH95GtԁG{K#Zg#+,zA#"W1SmcjxLMQ:Zh!ϳ׊:#y@c9c{0E0RkN`G`j>_UtWPoUKB8Sor7ŜH'K=LO}ȹQ}unIHpn%6өI"Yҵ̯#}2$)ҧI̿@9/ 5K{VKB}J3$K 3BF:פ~s-{.#Gz=ɤHo"Az\;H#]Jt9k '}t#&-[I'IKQ9'uƮf;Z.kc4̣\uR?'l T,4כIgfދ8FsIאeu~l\Of'HiY#v]`ɗ|cE``Rv:SRWf5AQ *NUPt,9㘿tDe2SșJ:%,ah^gҙ3҅_Y̚K_F4[ϊt93tfy-o%}mϓtn5*Ѡ3\a|V~7U66@{ W<I -srJj }j\j܏zegj_ Ic9q\_)$>՗zj]+ ijn^_ ;◥vȉv2e;oN ^Sŏz):͵͒{ߒ9Uӌ23냲['+)U:UHbtdu9#189$'X;783sfԪSk9ΥzH;HT=qR y: <+m>Y,FKpjRHX,CrhY;15ZAh-DŠMlv'04,ƿ' ~/қdq_~}d@(}#Y%+f}zy6ZĮOUR&6^UD;Y1}H }z DGIHۢu|uRVj[OIO]eY< ߊ]c:}jfD_V2 ieAY>XG9 !"j 4-O2ZԱ8NKȳp·s|.rp*ur:ttT5 jо1s~ XQ{38Sp ܄ff[[yWe$.J-yR"UtVa7*$'oGYWj1h0\fe3Z?Nf~#уYꜥY9K,,=2Y,Tae\'5Nctz8=ʗxW ˾Iu.ܭ杳86Ok[ϣ/+X -m[a (Ě*z~0i {u5?25gY֬3w& Ukmn0O/]Rʜo19ߠdUkd5 kʪU]bZV9*716sjYb7@c_Ĭk7tJK̽50Q* V0y,e@I=IM[/,>,j`kՅͯjgn3V֡,A_UYh4ʣ_Yv>B:{COl9Ӝk+hqYV,` Pk60uV`(&f!3F;i=}j||r`F31;T|3lW.) 0ƣd?Jvd3{яk5VMyΚYEax_~j_ B](@5-bwG cײXcUw;㠌..c _ #g(OoQ웻zY04jVmwt}[fmJkl >"m>O;Ѐ^_ m^a=-7֌F+i4;4hC i&zOyŽožapkzpbBԵz68c6׵ݺUJkkD9mPn@&GLF;ZV!C`lSɩi5DJD\!*_Dj`߳2?'^gRsw{M;.^#׳Ru'k`t^8Ĭޙ ߔ^ț/hEUy}2*)W؍>+2xk2_q5;U8u?GZZ;Os'[a9Ѳ̪Kxpn yO5kO_H I:ŸbSN1)w7CT~{e<ޤz׬~gjj*tWnesn_hidVZ8SWH 3}\ DN=)Qr*ϔt?|ɠ!~ oӸԸTĸL 67.lLVàgUƜWpo"D^QrbnTX "ߖwkKr;&7c12^'˜ 7dYƊS;m8s'*FRKT2;#vx$}==Wt/U1'K >sd6KN:ѿWy&uE7$RToSuRu*?ER]H+?rXZZ H_!-\嗝ղU%;~Ucۑ&&RSVJvۤڜ4!8reEjQ"qW}ZIՙ 5B٥ HO$5ǬqqW(Lr2i/UuHJfJgJ6VvrOk>Ou-]=n$Տta}c1dX$^P7^Lަ6`xvq /P8 n)yV0`h׮3Z/q)zF..]] .!D?~) 1ڱڠg*9b㑿=zM-{6o:OGbĎ/EՒ,л(+U|S|OƟb|'cA/q6-jŖ"ARrngp]AAK]\kv{u^^z{w0#$ʽr^׻wJ'SAr7q7vw_|w {"qw:y$z~^?ЋA/. һ**HPB~aq /.:p.(\[ T'-Gװ(WM}=:~MH@۠$=8ΞX%>N|,9O_[oM:ɨBZBOZ?mX5y^ M2.穩a+O+#| Su^cg3ooUw:>"LR9RT->X5ոpTŞ2]5BĪj/1f; K(*"8֤0C-Ú=k:2kybt"LNB~r)Q QxOgg?Ocj]&]C.`p/U`9ZVՆiaZgvf/R {_lee(-͢8Y33u`KU֐~߹'3yS?4*yL˟Q.N-щrevAO'W'cgKJut,D`/{tb z!eX5CQ@^L(zbGbz/%^BN]]ȿx+yͿDBFX}/.F~ PC 4eztEt A_FW!~WGW#@DנZpD>zaq!a0E;KEM&v5,ߴ$j)C ,Lrˑ__J@3+???:㕒+讁|5\jn !-E"L|&_/a⋰;"{b"tgBrGŨooaGcw#_骱+O$i.alal^ "Bx9ȇ\Է8y^8|E>Ő{ȟ ,|W+݀VL,뉼B.wAz}BBp1]o 1A { 2` w9WxHo$A~yeȏʑDWW@_^}{ zo ;wҷ=`rAwAYYUgU1T>1T>1T>1T>1T****gM U@ O O O {XսQ/<'=}y稻7Ig.zoRoEZHpu$nou/&~ !L,(yazqn˨GDA Xo c! ~uAOJa76*vbϕdR}[['gboX[!|7q?Hx_KSxG<4׎ז))FI+ ӥu]r=&6IS=C|'"OI1}λt-/wGsUzcSzWtQ}?"hW%33rk2;^K \S X/ϯ>* w +dv9vyUMHZմQk&ޕѰće mq,mqW3l)'MҢ\niK.S3t-懼RJ?ztRf|I ptk@% &n^%O?Wuk'?z6D%D'.I3iJ,L$ 'sKFI$Lƒ1tN&R'Y;YG&L) ~Q4q6MVuO*N~7*T|x*?*gY,UJ1t+\xVQI{I*D28XW|r=j\<:+3Tx+35ˎ?K&ԊnqF 1cg+V?V('{Xscb$kk]m-NC:?>"IQQ.m4kW}Kc?C-?yb.\꿢VF }9aoPa# `1190WP.G9:k,ѵݬsG$ϏžY}^,.G{U5^[Vnc𪚼,g6o̺Y/_BQH<2M `6V~]o"^P$l_0)XjOA Ѥ ګdUYB?AU66;>ߚ<}%KI@ [K8^x5Wx<&jҸtjܠqYx+('ʇy*9-DDDv2 !%%}t4M4M5b|51cq0!p|cxúG\eW߽43̾}u߭[V}߭{1SPG˘/Mj؋wYT\>v'W7D^[ |xDgn\;_7s5s-2pȨ8~ߋ޲TBI+*sP\$lJt>pX.2m1| =+Go{A~[0Ro{]'\G|9.W Qϓ _C 7J}F}D zH=D)WU%?S$ 2WB jT= WRKIToJz$Nwpy% dא6]{i\sHrs9X R H|VzS^$roڂQV+Z0N2q*ŐƐ T! tb_~h0ԚLD 5 -d/4P柉FB8mIEKQ5jDAۨm$k:L'h_׾N.|ava&ڻY8Іae@$* +x\r?"I L*:͕lіe8T2!({!0AM4AGCI5^$:dHi0M`s'2o0g@T2( Ѣdt(=JƀYIC?Sȡ3 IJ5q  D9t l ׯsʁ3m '+d7eNu[ t5¤@4ʤctPgt,& jyyK=@L&!<~Brp 2|~/@u+q9Ieho5%ͿYhiVZrk i6<2Fnv6kI.>]-gp^9| q.--ԳhɎIWs3ײNJ6u1Dc]L8L_M*pK>:QNӻ9r{97_C/MpYX| yTa$ښeՆ${Hq6sR%W5A[~]ߔp*{ 2KS̷S,)6'rm|=G,}>h`asTkr}]KS)}usz>IfC! ڰ&94 k0dְz\C.hny<>aDV>eYi(2$Ca Ye0L5p$518Klp(&]?lk7J9α |Bx,΅1]Pw?`^L)Q/u47-C{Nm'J׾ 7^>m{N;GO%+@^lL]|} le/wsEux #kkIIQO0y< : }9g zgIhH ]$SdߐLO4C$\6j~$͒|#cI/D=G!/j?)~R[Hh7k73άXpfhj ǕK/; vbġ{\{LXGܨyP׫JMLM$dCϏ_-z!> ^C]/P zF /u_$%] dMFvkv&UU? _ԯկ%_-W|U_o[V|Wj}5Og ?Ogf=sͳxD [Cp.,?΅YfYYg. 8'sq8 gpx[=Zx> IjEj%QVu xƑt| mI9motpI'f+1YYap8 Mx/kB?C柶|Wsu0Aӕ.p:ZCJ8D,"aO:]tΈ:.N}.5k\_6I?$XYJ(-⳸*Yu^@š~XsJ4"a/ө=G7!$,tmT? K=%Cox>2j7{Id >=`zuO렏{ ,Yڻecak GpWɟi_Ӿ.>r_j縦㸦)4}4mtIGu%Bf)6cW^}V/ؗY/ؼtݓ=tuD>N~M¾̎2짜@}>_׿NܸRO"gIPC|5$/Wzc9y,J[kܖd{%Z^ INVjX tnW coYg }ޥT?~Qмg`L+gؑiEcIڿN!B& /j%ǓS<5Ȳw x)l11Fmbc.P>=QYGQSZTDS}2N8(q~(NmZűgԲ-u:jQ˷8V.Z2>َdףdR_8FT>LT>'Qek=|^CPT>QdQ%lnjQ,7UOytt>\#QҍQҍotUMtIvtpx/[wmO:p07AWkO$E(<۾l*nbɩO99 S}*ܧR}ʱw~rlxor=_4b0 z^H3qO@twIt,Hq;Q<_wRx;멌W\cP(_EIĢ$PP(x %Zw \(Nyo>?wXp8xBM6.ȓo~91oDž4sw3pz<~B/!KDu-Vd`}8VZ7sJSUN7BQrZD )G y8) t) Qg^< RSʵfKJ{deޒܧ$S#/q)dԏI8kȧ߷#KWB'łI -X,z7G7Bpv ' ĭ/3_p' jB׀)oGzNJT:9GI!~h8?_ j~@N uXH}SJ+$u]IVCD/,bv~om!0^? %  4H@ÅdA+ :T/ ơiEa {!yl_&;x7Mݲ3!owM^>ϣ A{Gq[$Bފ3Ow!ߤ ޔqRm6a 4aa?i6ڲ-LD󽶰3&ԢYYXu龵 EwZXOZOYO[gpF';8szzzߵوu-hK16{ζۖa[Ǟmm fpE$ͅg*y(ޖ;$Zjgj,:M\5rIFUe{$nƁƸ qWI 潗n_ra犸R$yi\yvn㚹}\wȘ1a;us\?wFqawxdp׷?ʑ򔸛6ptns7Sq)6 #okp&XJp[ɛ_Yf${.9gr*.K\`2lcJ.cM\1glMss~p!kv&n/(9'pmGQv;b'7pzQ[s]=Cж%>H{lϖ>`,IHi2cx`Uv\vMcwzv})nNǥsYz.g{(G8_aOpxS\ ^rw }9ge42*"7+r@`^` lnd7Ep,}Qr,Vb]/ZJX/4[v7+dzKJJ%]dr<3C0pb8;rg"~ pG[޼0t8-(Re8|eQ$o~} ha*$K.gM.c]|k`iJ$y ܤysIә91ߣ.l_a۶hM[͍]=ݥ/~i>fg>Sӛϙ[6_2~m[,7̷6o/ 4=pB,/:) X-OӒA]%33 Imw+:t!|1^%:M@@D-d -PP&P6PPQ Ie2rB@@ @;MnJL"(8 (8UQeB1pLsDeS6'~sB:ҁA?bΗ 1>1Y '% `t1\b t -@feWXcқ`aG^G2Ol#?KPiđ". o|[eliZpmi_)}&, 0P\7,G,qjc% ыjøٸx ^um5W׍7oCʔ`J6iMi_LS)ǔg*@,^7lo ֛U;MMVS`p4HGLcqӄipt4cz`3ǙACL25K-fi:`,<$w̧̓0ʝn|ƷQΚovVl$ c1X2¸βoTpRj,E)wYAV-agitY[-~0 vN `x\ܴܶL[ ~U l2?l6<-fMStn렘m`w6_̶^OGڣސ v`cD"S` Xua?4d[+Jh!sr.qwZs;NcISi@z ws5wfVb$+pjfXיOZ7X7~7Y]^kpu;nf>@zUzm[[^^W׭7m*[-٦2mو9yb@谹`^dkkێ؎NlCۘ>A!wpglls|ȧ:>=Yz@`>_ȗ^@t>Xolw[;N?ş(H]VB7HCnw{uGQp!I`-aGaMBP &(E)w ^pp Oh<$v DžnW9B/!^ ö&H]-L Eռ_Li!Qk0f9ybX,D#w~XHqmo(;T0&;R: w92َş(p;L#n0lplrlulwqup8!Ljc1qO8JI@:fseqe ˲֗ J,e ;=mCl vIe{Z(Iۆղ}nwqup!Hec-{}=rsUSN20J'+ +K,JYW*U6ŕ*T/k~w9TB5շFgQ>@$\ s4B2Q>q#&:N(VBi H0v^ ^a[f;fӁf7X 2!B9\ tzRmis K+끛ہUMBMr&&&|&&Ʃ)ܬ)1Yjl5w&TS_PfoMḱ#5GkN ՌԌjk&jLLܩyら e ̷ %AK0;A! z`Uۂ܃?x0  Gׂ7wD@m4ґmڤZ [y7n бvX[TIL-jZWd6c̭kwm'Y\]m=T{t ZZ{Z jķ^;\{)j/^G\xvuڇ!U(!ҚZBiPXB9<$T*C-CPHCPSho9E< rhΧ1dAC֮D誵74НL⟣޹WY\~"F%-)RD 1B&$K )XJA-P(("R*HE)RED.ə}vb9>e53k֬Y3HniRv`kiU87)5 0.<8<|XaápY۱#`xݾ6݀9P0<'},TtetM+ѭGVFDJ<7z};;;!^ZUͫ[Un?unW?HCά._]R]Q=[c.cӡ.Փz[Yճ^PzYT|uToUOF->R}T܌YxNCPx ^oOOόώϋ_8XW[;?%DDDDnSkGW_bDY*I$S2xGZ$'H\\\?lvrcrKr{rWrodm䩔򧲮;N:SuTꍩ԰T U:z~jlj|WK*1595-535{SyFO-)SK=U\ZZS|,bzڑڝzG;SRR uIեttttnSkGW_z@zpzxtHkIcґt2=1=%}D/%JII/#qc 8sRA@li<ʳItK^$ޖީqOz_ *{GPfGcoן>>>!H׵m#ƿ24)8aTQo5Uggՙf :>ewoCg|cWsG*ϙj)"K٪\UJo2OYMV4FO;3hoPGi׶zZ? tR/觳~ Sͺ}U{=WMϖw]]?觇\}~\}.QuiO2i8K{˵glkϘ FGu謮ў}e@ ҾB 6*qZc1^]gČgB0FZ77bc wwUsU cc,0JAAU:uXFc[U'7llW 7}DWwwS7{{K^^f??5_/T_G[7aXݮ~=z*P8b:uIS3iNԘ@,L L L XX , <XX:m l l  |8884`V0;v ӂ3uyǂ>|J+k/_;9kwڻ`yX{>c]?ݰ`ݱE%|OlyS1lVb}~Ə;X{!~%>@[{ʸ޸^]_a烵ߩ3j1W0:|qqbڟbV^blv^j0vQQ_P?!ߛ˕*^:^im?wG}:}y-ux$ɳxo{aN;%7c:eI޽9Iwf$a@Tܚɝ9ISt[5$:ZnvH,7j9O&gԂ-' ظgkeÃ`Y$_j$o]$Y}6Y&oU&IMVXV[bↆ7 sAA"&/rioXH8i;:h㇦^o)0zd|?(M9Mn)OI-n,W\ҋ#_O:q9rJTWb7&N-JZC=w J]Ir3OT&w%oX2[IS|s*7\WjK=lɞK2wMGKN4Mr_ۿ3Ǎj>Uݦ~FkfLt$7 mm_2p㨫=0USɨ QtJ7I-r/VZ/|׈QGmdvG[ddMö́օ.,[\O.,ȥK}j&hXҭ<ܠݥU2xw-˺Ӱ~kdJjXS2kKF;ing뱓;jik{^Z }4Lr%и$m?ҷ[c~I j&Jj\#%5Mʦkd:IzP>|Bv+K^wK}4_c4ܽc^ݾn3zܼ˼wO[xy~QR9?W֭n#rG/~K7έ̫0fYQ+ʮ."ml(O~=޿l\Y,͒vt;}ʴl[ɴY]%/.&l+?滕EDeK,[_QƸlKvmWkOʎ_|| _2H"v'y{b ww >T|@5/6KdbOowv5uA,1" /#Lcyɯ32%:o'qc&5ƉMm 1]Ӹ!I<אeby{c3_seoY<4̭ ?z*1Of^5~Gb|G+/I*7w)|W"b,OM|i"_q|gH& ߜ$s9dLQS"_w&c&5?=L3]3f֘{g&4$)Dj?)_GIUG$wUSWͪWlW%tՂEbb U5G ѣ櫬Y /ݿv14y^Z8>8wA =ߟvΛpI8Upi<zg>4m͸_NpGs`Kffo_88 N:H-R;V #2Wvo+hk~D-M)h̄s;~@WeP8kyVhexs4{B{:zs, 8K0зB'd0Ӕ}HmGhFL .ȴP("By{Q"a#|V5sDru f:@Owùlcp>߇86OL z'sD5@,Em#d2N j=4|Z}ZW =7˳ m4zd4ͨYAdZD083%@X d-rZ#lӭ,V"2-Y"oFƆŝk>lHxT ljk=[j=>QE|ez+)fu3+Zعl o0.#8j7"f0xbV$xQly1Wz-/'(Ao,+9^D6ve[ &bwOAPu3}5W@ͧ;e>zB172Y_:G8GDq=a[p!| jZh4UFWvƋK2z/T$dw/6G h_)hNg1vO -лɓGLJZ[jY~N!m/8H-ca?X̦lΠ죢ׂh) hq$kooӒQ{GhIԴq#zDPOK 2ZmPAz|zT@ DY4][[ňPV9jyAMK)EB[34˜_62yC2黦Eːxl^%1{r/pNAM˨1vQ=Ӫ_fRj/*= q Į^/&oAco QڹOx 6zNh'r--CNXioO`Dr @{@ t7f͠ˡˡK5/AsS u;u;ֺz.vuOkϺn :t6SXKF3IpC)Mo4K誔\^JR>w25Zz(E9ؖslvb HhllMӛ#[A-GuI>j4>B25-}B_>vZ˼֢,֯y1R:loE8G_ү~\Pү:iɂ!X4K.z,C0q)-^A/>E3: O h{:o,zg:u̎dÌUiKizIvOA3;9?$ͧn8 6EN>rBh2 |$Gd>V7q̷˹_9a.zGo{-M6+XcVy[Xl.H;%%hx oG6F27ѶIB XӷzOm^):"A[#: Jp;COhB4f.D3yhBj3l.1jN<)lh{v{9w<rDCƞ̼ jvnfIΥb[cbJ-Fr19cǘdFk_ :(#K;NyZ{@ᴁO#Ѳg !wOs;ɿZNDK5mu=o#&ϖ-OTk(MkăBos+oK~g"YN`4?SZ/7ZjL[DĄDo1!fU&zEL%eo'GG#u Us孳Oj!V+oAqZ}ކ-snay^>w>eߢȬΓR =i A^-=Lf^M] hr82;k3|AGgvNj 2U-ms uo 3iu[twiW{( ȹ NSvN5HkEqgw>lv>dtOx{=_[8O,W7 ګF'%s e_&^}_6IS$y|%3/d^ʹ:bu@,mjIϦfaw$̒k~fkA3QH䴠qs"vEyXPӒipp̋A p;"g!w[ ~ӣ7u`%ny}owLuloݟ躺JeySJ8)|coYnN8OwosRX'q SOA {i)Z; a6{6rfsSu#3YDZ Gu~SAw%3F7%5Z3(6l <eIY;,Rhs$9GJNQw=E]"lt.u 'Ɵg LUf*%T$ΣK9[JK 5-G{ٴSO8O  =JLu-xyt6ga ih](v{!9;fB8nDLA3.+|Fc’gܽL)̔ϩ'eׯ L'_hf4^4§O [3E~+sXlv{P9A̩m:\/xp8m﯉I,^ȼz]='91_k[\B#xi.33fg &M6.eFyeŜE'mhfw]_yK{ οEK2vg mxH$K6Ffж" ~8齕颺+3AO@nx x (n46dRnQH-cRuۓz^L lӣkc ^_r7sZ%e-q`{;9!J$݁H؀ zMK^geopN7螅YsΙ2=C!HB!0%s̙%PcPc1k}ZJ^óYZ5z j-k-ZkPc$w}~fذa/mcO z&)oJDNK`Ƈ+ ȡ:bW]QT/E p y.l!]4w#*(=KGqڋi;УAlF8x'{!Lq@B*"=t#C.;d'K/K$c3\[iSlP)Y4}7_b9.O9.89 aD"?=}-v:7[U-4g]ϰ1}c( ae%mt7b&A\eĴoCN簷nE1ȬAL#Fis?O!\h> Y[Y0oӊHC']ElhZ_*B/ߟֆڷh`}yYxuEzῶلe1kqj߿&So~aS0&=!5ⱁwȴ#o|sː=_KŜK=&{o {9x?|;+xGm}&L>YnOQ(>k(p’9% 5\:I<5NOsadZPC 8RºZ!y༂vNLo;%s:/w >p'MZ$oTr"eSN2 Ob~{}9D;8s];Ÿ71ok.zEӄG)s}Kn`K)Ѐ"Vz%=^Dڎ]׻Cz^N/+i3@ף¯ȃqtGc.K|hp>Fl JD s8|~\K{M֛,Y RpD컊~{%t}z~uxs:}ǿ ~^m N)8szb.υ= g9KNTa"2$υڹeӑ@&WE&{|Km2[_,^*|9/%LZcHsЂ po߷?;_&Vh\{$lo5e }øoE)o+R+_ks|Jm]|L2 v>sGOj$䫑y.fCS>-du!9N iϹ{ ɑ(;J vMK|9KHB.rovRi8ZBv~ C>֣;r5!χ|H( w54sv˳?60a0'xN3wE@3xӤZ>s,ݥUЪKsI㿕ss8pNqi~Wvɻ\eSI'GysќF4+}>8[pwKn ֠wK%ϻ98pw q:ЇqC{&%\m{y3. YeY s.%hU;8 eh.bh+FO߄79'I.spwj. B2ȇA(_UИ 4 2@-̚ [_۠6а"V$;0fwk_ YgQ6eߡ!s 2@>Ƞ"/ e%ؿGP(C? !oAނ'!IAt$JJWfS)Ӿ?RXVWk^ :,Bs`ڿ@QQՠ!t 9!?2 3 4A8]haxďwWܷC==Ea }';mQ֏R%W*߉5%|ɵp`!*k FrWA4Drg3z1w݃ Dp,̂\'asЉ1cLn=ӡg:A? AN>ۙu  x>z?z?AO$A!_{64RQj8dΡ%P>Z"%b7Z ~σ~ X"{%>Z]| ʮ]г |v<< /'|0aN̲YN 3 k* B'h'&qwfՌXYV`9CA# v|+^N*;|+]J h؃Ka|b(Z֡hbm5ڶ4q 䗀F%/ ?ᇓᇓ&cm.X0VIXIj NJ leM_A+"«a$mܵy wEF?FUrGtF1ch =ǠӠO(,h 4=W+} mUU M)`6ϣ]dx&Ҥ$a>  ǠwށGƃ@OT~A/"@yyE=j?ڏm_}\>.u|̋y=/AVNɍEt~^π| :l$7"/BqqtJ*>E>Qeo(eExc+QJ1V;V/ w/1"7 qWnO^Dr}=ɍ4'Osx)T"b*zY %\9לo.2+̕*sdn|>yKGIe^0/W,fT+aeZVoZU&KV5۪XeV`lmvj[:jNYg^h]Z{lvAR=Kmۘ+3DY( i8vp39l.RS) Q8! 4܋SlpNi4pJC.Nix4ca:(M) qJ8P~~ˊ{8AY j(Y 88 g52}l/˗*pVC%jg58Y 6jg5|>&>Y ᬆ8aNiu?j7>~J PSfJ җSkR{Z-^z[:Ȟ߲g/Rl0D4Tc1cXb,7Fc Rh6-v{60isFcLdqΔy$"ҰHGҚHSdc9K-iޏH{K"Ngh:P!)I&$#Ȉ/yyPzTaƔDV^M~ͽC1͘a2"/-HZad+XKi=qMcMiGH:'&&*}T7K^']wF}>i m_2W,p-̎FӢ#fu4;5fKh!-Fk@~*Z!ΦTkVESTw W.&,Ejs4.!95nK{ѣ(q"z*zyxbrYN4I6SuƑ8qѹ:ĝtg3Ǚ,4R%d"O9˝zl% =j:kW SA{|e1ӯ62x^퍑1fsm'm3~eTۼWy]S=f!L(%Tlw1|s3s K+]\EXKX_|o65i3i3i3i3yTyxVî g뤫3yv}dQ~-h~g^g^(ZEEE{}}u5^&0b?OVW^ήw.-h+߳YR{eޕwZUzNf{"~|UƁ5b-p/!߿xk :[6oqכEEEuX?[vs`6{ǯ+hq̓p?~r!d;=>o G[[9v7Y[X]>Y'6veD g)W&X{XtEY=W=))=&ۋlBtpr= M=kP?<0溠b ;[$_v}3>7cf{AX}L,Z9 8;Cb?6 U]e[$l/9queSLe?:Mk^|xk<4˦XǦeS\c\qhS,cS,c֛1>_{6/9=mZG63o#:*퉦>+*{O<}G3>G)f渾h$䣴Gip1J>0J 7.r-bR+1c8 J1@bzwG7yFi/>c( 7/E)}|FLL}3Jdh;Qګ߻\+<;]Wjоd;kӼc_ݡˉsPۜ*_#-g}.͟ٯw_]>^vV{LlpǑw[m~W_]+ߨ طSf .FBa#BEKh#: =^BcDH!n]Z:!0z5gg\NnhOBj6xu o}uua?H5KˡԉjHrTTuUQ %rRFmR76EݥUv8viڭj&i)V-]F9ZVRB)4MjERmR[k-j]۩iCvR;uiPNi=Ss|PW2 ;@^ ZU_˼TGA[&~͔Rڡ{~~|}3w +?3X@ ,*A7CHgAap7&ׅt1"N `Vp;p>J٤g\, ~}"jMX{}ly=[̶2/7W$K!D={0qT=\y焇꥗{y=ޚAA^;Q6s {Vz+jҵ뉧V5Tɺj`e5ӎ +ń`f0L N V0FYR0ROg<<|\|e_a+ e9 { fDcʆ1eU١(Qr(OV%o˜ qg"b&ɯȯ0J^' }UPFL7/S+SLe2OYxVe\W5JQiV)-.eҦ+1S9SWS%5Et5CyjVK V,u:_].UW+UZuIݢnWwާPGIڥ^P/W4T-MejZVhiѪjf|Xj 2NkVk5چ1-fm덮zZGikQvZB;.j0vO۪/LD_덉IM||f}?C]ߥkΡ㮟zޫH%)~.KK2y]蒜+]r\,C2Qz= obZQ),:VxZ/Trx!1ra3Cyr2Rxy3?4ӧFQRJ!N9t74y@KڹnpB75sy繧sFGgI4:nU"Atp9 tLV s0T)^ ؄)J2-: )s|ea)Q+*eD/UԤl"l)ڥl/>Tvuh\Q_ᩢ>PQ_E9WN*sڈ:>t)NJBj4uI&*7YJ-06ܫViԪԃ>m&bhu1I38a*Qө<~L[-!,wjZVe9E[3*5mԚ 0PZzW8:[nlTeZGEk:cZT̬֣&֣uk=ZsO֖tIOe=E٩chs<@S&T+}>CU|X;4M"}Exyb}%ak]kgC?kMA}]ߩoբdY!~OEI v,Rݯ_/6XF+a%nC%%i%Œū`I$pK ,''P?DYT^5&q-{Ź%s?˭dAYkK’Q|${"'̕QT\dEVm.\Ɔɏɏl(7WB<;CA~{_WM6x_wo:#}3}͂ͅ9wo/~ǃn<]>V #a'{Wk:\pȾ2yp]a4^^pkxOQjxg‡G' OY3ʜ_,Z\T6rㄺeAIVw +ùc J2VLTB^8M)K1N] 6NXH9Xg^v'ڎH0KhPYyv+yy|!^)d $r640B@cEE]S[zC)!hz(< R ;)b i)""H=_ȍRbJrӈHH94 "RĈ)"`D9HSDȉH1}>C{Ͻ?㷞߬eyL<b<tm< x.sCNe jB`5V'~KlsUfCW稥c8>$A]Hx:)xgS6ק5HNyݐuy3|t7kjN;M7@jC߼ooÍ}羅ZvI' d滅*/bU;)L}֊k*uOvX-Bׅ7u? ʙۉ/f oz7S7JwH:]o6-Y#kǛ7~z >&^ό q4BU ]=\tG'gmS6Ĕ{]BoB I{V/JzgxoW="+ĥo1|HZNҎpof;HawRO  ./w~a=&a_ˉüc~?O' jS3D?۟+["X.iGKRWk7[o~ '8(8^+wVLk0T% H.n~_JN I 뤠J0<11ZJbbbJb&LLO,/T%IU \oMl2v%CD'?q4:lmRK 1ARKPuqiA%/J(%+Z:^0N $b`q27 V+X$h+-+8@xXt'XzNpQp2tcY~YAY l` NX.`тq \O.*o-,)[.|p5[/$"&YROpPwJ}`N[|"'9Sf(w+p{>PIr ǔזOL 1$&Ӹ1}}9aHTBq$Z[%.%XU|JxA&_~ªUta@U(B>4 GF Ɔ9fY\ϭX@XLt + 6V4 ohzGn½k8\q,D a8B0J0ds˂I%/(8 "sd/A_AQESr@rp2.(dÒ5q Tقya o["X_)_#X/XܔB- 7}\اaHi5ax\%> WAxJKe7AO[ٻ! QupHʉS* ȝ15nC,\+עSl\5JY*܀ )~h+~ 1 wMO JwPjhj`TjRu$!:x|OR :8>%l9.딜RՂu6S;aXE /WNWN;tE^oz@z=!FX#' JtԹlg! V\F^)[;-}a:>p<ݚ>#8/rAn͸.nr=Ožނ~&]E ό |013%eff~QfͬU,gfkc*6Zok gY/Ii=gqeB&)=z_$N9sg3m } \wf3g}9%ie-moDTv`ώNҾl?8;K0W ˲2_~!v_] XʯžZbS_Ϻ˱_ Weݧ[VG?jمQa9jfyQ~U,Z^ZjHJ;q^FTnLSڮjU'VAs mS抜Uk Mr_-;Z>?BКz',׼neݺNfd]4uFC RnYAX,^#j ϩ޾-.z qJ22ðT}Z\=>4k*S;sj9VRn'v91RQn0*i4})|1CI_GᅦnhNhd h}ܑݑEz?|@cʈ V^O C,nFmwߧi".)×_ZI_ >8ȓ=@7QfWbPQe[{rk# /QFƀ&f+s{h}.E A5 b;4}Ś ~@ilgki3з y{"iS)!diQ/:z)_Wk?3.߄9BcM^SwFƥriGgq[-vA$7.ަ[Hyʴ.A8ZB4q|@zױP@#KTwwSqDҙ|M,n t5NK=QJ_]03i^q-6SVd.:M#'sꉣwG]LYW2ywrNTc/jsW 7N5LMKi)2uW~/=ٛy C3^ZLn'OPG:bЊZ~+hҫZBW08w[9=|`6cV1RGc(V3oszAm-j@%-v +hMc6JvcmR{?)kMccMZ}D5ճCjODk+\$b*]n1kuvIm|;bk9_&vo$y2uސَ7b n!MIbE&#Wx0$B/0>#x0 'x0~!k0e0/_0mxX0^?IP'kfa!?nx:0>BУ$,0jb|D 0;`</)` ~ `|^z G@G 濱?54V=ВaXm+H7M?v>;Z7.%|cWjl+~olkNol=|`X?roƦ}hر7vZoKFNo҇-zc><\ ;-o{ƒ!ox3C̮eAižVox.w< SJ4{ `C>Bis5܁*c&}"}{EV|Mv;?nj-Cɟ@o[w]jE&{HsMP nZ7м%?A!(Vx4Cr+w_A דRJ@ЗKeяs$i{K~ST>f9 J31v>dPי=3-'i.wq4k?umw Ao8-q]/+O)i ufۨsLysʃU:^Vݎ2;-~W3Oՙ}^gic촦/Tׅ֣HӋXfN^9UZ؝+9O俓2Sݬ#p4KGݿ:OJK>, q0 ^R$VP,lG>^#W*c&hoއhŷ ֋Eh`3^w? \qr w-Ҍ$8"H +u?8:A ;DD4Y7A|b9|sY6}eP͎?)[ nً" /3aǶhK]a?e 36{7e%ҳofVFDޏ6F͗h֚C_BG/'f`]ѯyD8.J-IcVIS1MS:=gE͹ͻù'z윭-;ݍ'}]L[uj3F.k?B™3,GKeOc+5jˉyw.֏U:y'úsmݭk̙i .giEbK[\|8\z:wQCE6s W*HV\#Ҙ֍Fs9¾a.f<93"gv s*(!bW1Oef avy;E2]5#kr\pyEp{^aS.BCoۜy\v;35c{؅v1r|Wѫn$OU܇wٟJ`v cpB*,`d!1&utIp 8̽);Z̐'9!y)|òTfS.{cp`o ؝:3h rvJ x`I L\E6"|u7!hr*[FN Ts͇7ꎡ-<^P)@[j$_kb8MD8Qã|Fyl?o\AG~yqRޏ& ѧќCM~#kug ꛮ("EqkhP9y <܂3z_`8u'/w!'!H#;ɇ7»"uNt\F_fr2= g݇y7=SNhmw GBup+F!Qa~~vx>܂-^@CJx'觢сȹ" /ʎ1ʣWT"?0>j-~uտfYF26c (|/eϽvr.h^&@"L4H 4hIczm"ԿWl3z.5kmRV~G~M ߩgW4u^*7!SZNr'lL{ּ|4*UŦ*2@C؁"eOp>ꎴoc?QoVUݦcz5hѵ*)ӹ<=v}׳;{wJ [ ȕޛ˨qtkE \_MkP4F4%d%0cg]ȣzD})\5Aje]MO#|m|DD|-5^C?ÿ,i˗myKp-X|l~`eun4tPSȍԪ'eBrE9(g HjYտ~\]j? oWjx?O98ܷ U+32Fʗڊo'3HM)9LHY3-#Ӻ7~۩d?gMeuuǖz:F 'h?. K[ۦejOF~MMv~%szFgؽ-˨gYH^f.O-~}ќ Y|пt}F@w^rз"DY'4%a˜ >o{Ve2̱wf+Co4{Ѩ'ʉT&r4Ü&9EMb|&{+[.Wg>R^NЧOg35ShAɯ0>~xr1Qg" 5|/r<5<Ww"tf'oғ]tw8WB:]9;NiܐMfFnVwKUk!V;AJ9:ߪo^ǛcgЏj{;[kXZ[l4'w$w {' '֜<˒ƶZeTZUWf+kj7^9U0]0xlGT)o1. {SL-i D/( gBzwpVQV +d v[D/s~$sUpFҮkԦgdI%p|eHlLA7iIwEʹ"e^k$0tѵh:VIe:i*f vI~~iQ'ّUr }wV쨤=*Z҉^LJ?|ҏ.UP.`P}I&_0Nn{:%* ҇q#dnJRɧףӲIPp=>R仦ˬI lJϒp``qf F7f. (hv%`қYWM-\CeK>P]ӥc)i i9M*39!拮6H4BW 67gn_f{BHyCRމԴʂ)ʂԴl0קT4*(*>U J}JRCðӌzTI̎j̒~V5pfNHm_b2A#|sja R޺0vvV8vIiUNu~uHЫ:?}`@`@jEu P=Lšԡтq'& ƅh|z6&ǥcILz5F?Y0.Ds=5}Zsv^W&3ZzBd_X=.xfMu T=]š% /,"q!>Sճ K+kWo,,,-۪wVU>R}Up|+`;nC{i ,ǣ=JsUwf˯ AVe;_w5(]{o-s|w =+Zܣz_.5~ӝC,, a߹ yg}7(gm'S7z{Q``W=7@:$8ݵ[x~I?Zoڽv٣It{^kow{Cq}8NWNq&8uN3Y,uV:6g9t:H,-+?2$RYYY9999ZntnvǻS,wmt׺fw=pϸݫQ7Z-F5ѱщѩцhSt{%z z4=m|K"x"~_y-{޹ї;$~~˻LlrMN?/K1?Ᏺ\q^ʋ&~~?DվmOg>#^7˟!l[OVMGz $ ja$NZ4+k&JFc4j-'%vWeaFInVj%S54y5N6aZa3sJ jW%ZL!_/W[cpvɯ/36'h{!aFG'|RGOqj){VG?- [=a'%%Vg Ւ[s۽Vm}H^vοV ;/9{{֛-Vګ5>5%RӚjq6)Be] %}1%If+eov5aIkK~kyw%,anK?]XDa؟"HmuK앸w%Ǒ8X=Pceuj\_-7GoW,KZ MIO N cJ=(kAF5{;v&-Zg۠u.zjm%raUE^9xs7+ oq-pUT]{.瀈s8¹qn8KxC"4E23?S")*QZYh̸k9ȯz߷~Z5k־̞={f7s|Je2Ι v& lN9s|κdo)aI=^u02,N+ɑ|CSN&7&d=SW IW@;bC$T)#I@ڤCr7]jxp֢MMzR&g|bctoyb^i*E~նx%p_|*xw@᣷p}v}oG/W ?i kl{4;^8ɱ-Kn迦o{ ?g9X Tjnur O[vYHb(i,DE4Jۙ$}*}" A dp\bH60! w1a!62fó%L1`X 2uz$'OY2kk׍,;w,۸>cx%o#J/W3/2 冲\_e|GxJL4g:ez7wA{+4v$a]g\3>!;!;xpA čo>J )q:luaBRĥtO>jĹ9 l(XK8y'NDJtXHb:MDc9Kcwi,q0~ b~࿜.M'XCVwǿe7  RX+f `cg8=Qa±.E&\OHoK "y[*5`$ؼ68^xȄspc1K1KC*ա5*+'+p5PeM¶>/ $F$(gXsIḦ́e*ҙP5U,mp PRoЄJ(͐ }`.ѺXafӘ-pn _Ɲ˘Cg\Ì n;{zԙ=O_?S ~1y1=>3NCylcJ_' DJ T&(3-u?1=8X&f5}j \ o]CxKUN)B+L 91Xt=+U :$R\Unyh|$fDž'!P)B$rs~ 1 _3jIMҮ6HH-sʢ\׵#R&)Ӕ u׵-@PVHEmkUnr4k9TֻjJ^tH]lt Pl"B*j߻A*WAY;ԅ\WwH],s9rk@Yj^Cj2yyF2 sVY mLwsSJQ+$9Aj2ι޹^)FD'D/J\\W)H;\ecwCb$ Hug1V:s #H+gu yU4m"iŤ8#33/vi˝I+!JFP'b-gיt~qٺ/t!KLOZژ~xRbdţFa+(&;Jl5ZRԘT[F1io1ͭQ=`Dl4~1,Fo:Y0}}zD#w]@ws}9Y]>a-}&Y}:O#f734+>VN@u s]Y[PRָ[V{-r4I k5= 5 oTKQRYG[,@ rlslR#Hr[VYVR#HIsU[-e -(5k@#Wπf)H͒kJ@wZ:-5wYsh!E Xx9a9\U |\uHH:xgyyk'5p̥R|g&52)N|͜)]9/t:R4r͜-R#-2@4zY Eu,3}S h!䴛k4~iڨe@3mlRR` 5 e#44ݹk-jAJciisijAh\S)Y`rEM#Xv?2A&դ:*Qj)MΞScJNGF8SjjQj)vGV 'D TAmJZT%LrLڠP@ϑ8@FRGM #Qartj)ÑC@ʀFr_۾zƲZ/PNs`I9:C at%I ;8ྴ8y\D.'˓a)τ̒g1Q#a:))Xy8#Er_r?&υ6z-d0b{ K,]!K\wWǦ1w36sk |tc-WWwSnzcmkg;h;lyvlնhfh 3Z YNN @*T\]b:$fQ gͥ6R$k!hZrHN!%7JR;fKXtR+sIL#!eXt'r<@W"Yܒv G;䶲)[e˕ cv(9YNalI](܃{l||ଂҌ<%#ƭ?Rgem}c-*N΀c|"RJY+XwXw[+GYQ kMb a36E g "$X#(.ቻ$KIR RT,u:,u1.Pv) FBk%0i4Irʌr+ %YbrYfmdlame~,R^%'I$SY(wdV9MNc69]ƢrO{˙)enzu7Q@P>=Xnx.c&&z?z\l &k^b2*H W(hy#ȭ}p*8?a>߄E0ޜa 5,jP NHU,y%5j9Œfn_Ȑdcg/p:\w.גk]&_[!OK[%ݍ|N1]FC T%wqNPp¯uI ~=c@m~ku& A_N\Y$ϒ|$w)4)h! 3qč'4Bh=n{Ng=(eD ޅ Xa-<]J%D|hY섍(8~L/kG՞r9[ C}K,UX6$r"}X(L,վv%k"Vt# ͫ>`$Gҝ^'} 7Q" 4z).i<-W>Ճ_Ҁq Ck$q$|%njqVG^W}7JYVJB: 7VɎ;,IoɓD>WXjhC#{1c3j) ;."z n%P@ w%/D87u>0٘*)u":qW͌CK=%l/hڃvaU Z;nG>%ςpJCE^^?B;̀ u>[@,Uay)yBT'1_p=q[y=roJ,!{u^0VOhqR.(dwQqw]Π?L5@_JzoGSAmsQFZĩIYʎ_QbJq !8k)L/CVA KD;bt'͑r{Éq!"xafhq?:#" yjiD2=MymǏqob D#?-=r}qVaRȾ!VK89~;^!J$i4T+A-B-~ow+mb, s- l 7"Em}? |Z9,3pl#fXGpWnbs%Hn* ""Ŏ'^?rfAATb [cَb8PaOP8gZ'gp<"DtA""6 c3%q:Awt)G8q?@]~+ Z''ATa ď8A4}9ń_Liu5̏]E5!ɞE9Mjx3'a$Rdz_MRm}cWLMR],jg}}mֶzN\ ʢYusR dOr185hh;eY1;_]z}1;z(?;2e}>&|H@jajm$?Hfak28縿=.`B%qJծR[JGmx0dY)g zr?$30.ҕr -ѡpo/B-⣴?1tVxup:wB8B'O7?8]W)?FŻ9Rig] 47%0D~#΅TPݔz ]|{ tS0w\-Keob m{su7AGv'N}:F5}St1 1f Ђy)M-l_w&#?;ڽTc?貱UQWil%D,>C(-5W!T'bLqo]ҺUpO@ qL^.R$g47&abHe ObY>F؎Ov~ -.`TN/EO\BeҳC:l`I[F1?RΦc8bKtG% }ɧ2LO5|j{8ߡ/6=Q LZN#wEѽ^(!LuxG5IO1z $ړKm+麉Ԓ /D ID eE0gѷ8OqFh O<@dA<~7/tH6d{Yth4J%)I 6݅6p N_ -~eH:HcN4y ȩO~\%Y>Qh>V]қ~n$TRZ}=$d5a;cH*Hu1I$IuڰQΓ =Y JR@: %)De ((\ wE: $w5̣?hh-djp7w xl{c ǔԖh 29pϢb3vĢFzM,.8d,V.ܱF% (>֯G7Ҧ/UMNV}|Ii{5T/iY 977}Q]کQm=зS=zz%JM\C#ӯрQ'1J-M{1k—rɸ8q׭w꺺iǸ.VDu^W/䨙׫Ťl.*7Ӽ{~z mh6go_}цCTQ6]x<Տ-ťo$؊+Wǘk>=|tߗVɛ>kvp+k~z1_z2T<Ƭ/ГB.T u釟t&70΀ 9{-|1e:&vN]?3kO_mجR-3 Ԍsdlߛ⛖)|mY=⭚_ߑ[nn[yzUN<Ջ:UCs+QWp-LTL33altXN 5s|, {荈Y^~#AW Qj?%ޮV{걪[Y?'ї;m3 gw>zhAW}ܼ=Cߜ<Կ{'^?᧶zIkOz7I_LM?q7-37seO q'v>|2|>qpii/z){[txwł!ݺ1 oy.oH׈OغLi/ks; 1|;d_nms~.nKxy ]>eԐ{6!Ɩ_5.AO4lgV/.X1v^ZBl~rdǝ--~g=6#o|mI}?!'5O˙6USbEX>]Y}ٸۯf?t$iF[t7K{~žNE͌)ѷbr5' \ʮu/KE 6}ۿr0?&;'yS[OFzb߈UCq|Vɖk2a83%idiخ,,% TB 3 E&kRZnBVRhWn3=y9>τ ;-2gEzNT_f;OޕzywIӁG;#~mMD1tm|Zs>(Q.M{*U2$$c-_S|};mx[Ml 81%ŭ@t#r\HQ|=у⡒ 6M%ډ5q˚*<=x]۲+L֛}?{=Moz v}s}:ā"Z%}ӂ0 -yF;IRYZ&IR}_/en5̗{8zdW)kI[BQ/DCIT#|fTpraC +I@LJw3l}='X"[b0c%g#CfO-AM CMhfHǤ>B3sFiyU@X@Hyձl6صagCKX͵[7%M@TM ܌߲~Hii9UcJ,瞜b(5NYAgć&YߚZG9i=|¤wv5C*@O<+O}˺h6?$%*#'rx92&›j2/.#ox [yܾ(Z<|[I 81@RH8`שE@>W8+xۯKTzwA"%3dQpE]aZȹOͧcZV&KPAGW={LϏ{κ]|Q8[3w =᭶)Z?&/?3j[(L)y o#&I!IOmwÄ&]͝ەC {V}Zy왒jcތkD_]AC !P\ v Ri>*6T s++DY-赠(UvV`v앛G#ӁT CRi"t0߱O2o_r`%`W/6 PٌGAvA!2d/ X]dP a_Yp?~"Z{|1`&)yAL3a $EG1juj3R'IMwuMH4<}]LtF ѪϰŭFQb!CVCp䠘n$ %/4)E)̋c4jS~2E/e'f31Dnmw ]xf/YM5[o\+zYL0AOV$tVv6wFc~EP%*ѡ=8ĹHQ/s](qOg 1>Mot;o8T%Ki@-\>ۂBL>wWz>p9 b8Τ粙fFA65 Lhix1;<\r$MpyT\bOYP72Ä>w1G>$zY@:K9肝({IFFD>{\ٙ;e1,V\p4D @C\A@tڿ _JM+Wq7bjqก׎ڎLB◙\fL 'Ea U ]le/t'4tϓ#/HcKzMXg 9+L6#hP/PJ㲷HO] U\jԕ3:]9Nl"j5I2P}9Ón&wX&G{cdn17{耣+=3Myϐb'ܒc}@SbyxfrVȑ0eP -]I K=wf#{qNr=7;6P#k'fj#I%1yv5Y3o [+jb~Գ{ vCugÀwĂSWy_[:M%u NւniBWU8A#}) n$7h+Z1FCȊ'=E%;HPkUNjrqN5'oޫbF GkF:ͥv*wG(l! 6l*&Tx^#9qLR//7q=Kvݒz1O˒MCdch;!3s3`&L}{7fc &kZ =fl ʤ } b0R7+j |V&>gFt$%`L]$ˋN|K"« endstream endobj 68 0 obj [ 0[ 507] 3[ 226 606] 17[ 561 529] 23[ 529 630] 28[ 488] 38[ 459 637] 47[ 267] 49[ 267] 58[ 331] 62[ 423] 68[ 874 659] 75[ 676] 79[ 676] 87[ 532] 90[ 563] 94[ 473] 100[ 495] 104[ 653] 115[ 591] 121[ 551] 258[ 494] 272[ 418] 282[ 537] 286[ 503] 289[ 503] 336[ 474] 349[ 246] 367[ 246] 373[ 813 537] 381[ 538] 396[ 355] 410[ 347] 437[ 537] 465[ 435] 853[ 258] 855[ 276] 876[ 430] 884[ 498] 1004[ 507 507 507] 1008[ 507 507] 1013[ 507] ] endobj 69 0 obj [ 226 0 0 0 0 0 0 0 0 0 0 0 258 0 0 430 507 507 507 0 507 507 0 0 0 507 276 0 0 0 0 0 0 606 561 529 630 488 459 637 0 267 331 0 423 874 659 676 532 0 563 473 495 653 591 0 551 0 0 0 0 0 0 0 0 494 0 418 537 503 0 474 0 246 0 0 246 813 537 538 0 0 355 0 347 537 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 435 0 0 0 0 0 0 0 0 0 0 0 0 529 0 0 0 0 0 267 0 0 0 0 0 0 0 676 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 503] endobj 70 0 obj <<18C24A33793D3D48B07663EC4A00BB24>] /Filter/FlateDecode/Length 212>> stream x5нR@KBH AĀ5>%/@g3j:0U(,jt&\[ovvoґe>}r)}VC*ɓև!qWH74^uz=R.+׺`~`P .T :Ap!4p-8 [ͱB<^ R;% endstream endobj xref 0 71 0000000024 65535 f 0000000017 00000 n 0000000125 00000 n 0000000181 00000 n 0000000521 00000 n 0000004016 00000 n 0000004184 00000 n 0000004423 00000 n 0000004476 00000 n 0000004529 00000 n 0000020626 00000 n 0000036545 00000 n 0000036720 00000 n 0000036965 00000 n 0000037102 00000 n 0000037132 00000 n 0000037297 00000 n 0000037371 00000 n 0000037616 00000 n 0000037748 00000 n 0000037778 00000 n 0000037938 00000 n 0000038012 00000 n 0000038252 00000 n 0000000025 65535 f 0000000026 65535 f 0000000027 65535 f 0000000028 65535 f 0000000029 65535 f 0000000030 65535 f 0000000031 65535 f 0000000032 65535 f 0000000033 65535 f 0000000034 65535 f 0000000035 65535 f 0000000036 65535 f 0000000037 65535 f 0000000038 65535 f 0000000039 65535 f 0000000040 65535 f 0000000041 65535 f 0000000042 65535 f 0000000043 65535 f 0000000044 65535 f 0000000045 65535 f 0000000046 65535 f 0000000047 65535 f 0000000048 65535 f 0000000049 65535 f 0000000050 65535 f 0000000051 65535 f 0000000052 65535 f 0000000053 65535 f 0000000054 65535 f 0000000055 65535 f 0000000056 65535 f 0000000057 65535 f 0000000058 65535 f 0000000059 65535 f 0000000060 65535 f 0000000061 65535 f 0000000000 65535 f 0000039173 00000 n 0000039475 00000 n 0000225762 00000 n 0000226439 00000 n 0000227046 00000 n 0000227348 00000 n 0000391720 00000 n 0000392215 00000 n 0000392740 00000 n trailer <<18C24A33793D3D48B07663EC4A00BB24>] >> startxref 393153 %%EOF xref 0 0 trailer <<18C24A33793D3D48B07663EC4A00BB24>] /Prev 393153/XRefStm 392740>> startxref 394731 %%EOF